FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623161_at:

>probe:Drosophila_2:1623161_at:441:637; Interrogation_Position=392; Antisense; TCGATCGCCGGCGTTTGTTCATGGC
>probe:Drosophila_2:1623161_at:692:439; Interrogation_Position=456; Antisense; GATGGCCATGCCAGCTGAACCAGCG
>probe:Drosophila_2:1623161_at:270:335; Interrogation_Position=469; Antisense; GCTGAACCAGCGGTAGCCATATCAC
>probe:Drosophila_2:1623161_at:190:487; Interrogation_Position=481; Antisense; GTAGCCATATCACCGGGAAGGGTAT
>probe:Drosophila_2:1623161_at:450:483; Interrogation_Position=502; Antisense; GTATCAGCACGATCAGGTTCGCAGC
>probe:Drosophila_2:1623161_at:330:263; Interrogation_Position=523; Antisense; CAGCACCACGTGACCATCGATGAGT
>probe:Drosophila_2:1623161_at:419:637; Interrogation_Position=539; Antisense; TCGATGAGTCGAGTTTGCCCAGCCA
>probe:Drosophila_2:1623161_at:697:189; Interrogation_Position=571; Antisense; AACATACAGGAGACTCCGGGTCCCA
>probe:Drosophila_2:1623161_at:32:631; Interrogation_Position=585; Antisense; TCCGGGTCCCAGTGGCCTGATCATT
>probe:Drosophila_2:1623161_at:321:557; Interrogation_Position=729; Antisense; GGACGGACAGCTGGCATTGATGTAC
>probe:Drosophila_2:1623161_at:405:3; Interrogation_Position=744; Antisense; ATTGATGTACCACTCGCACCAGCTG
>probe:Drosophila_2:1623161_at:51:355; Interrogation_Position=759; Antisense; GCACCAGCTGACCAATTATCCAGTG
>probe:Drosophila_2:1623161_at:437:705; Interrogation_Position=774; Antisense; TTATCCAGTGCTGCCCGCCATTAAG
>probe:Drosophila_2:1623161_at:675:13; Interrogation_Position=793; Antisense; ATTAAGCGCACACATCGGCCATCCT

Paste this into a BLAST search page for me
TCGATCGCCGGCGTTTGTTCATGGCGATGGCCATGCCAGCTGAACCAGCGGCTGAACCAGCGGTAGCCATATCACGTAGCCATATCACCGGGAAGGGTATGTATCAGCACGATCAGGTTCGCAGCCAGCACCACGTGACCATCGATGAGTTCGATGAGTCGAGTTTGCCCAGCCAAACATACAGGAGACTCCGGGTCCCATCCGGGTCCCAGTGGCCTGATCATTGGACGGACAGCTGGCATTGATGTACATTGATGTACCACTCGCACCAGCTGGCACCAGCTGACCAATTATCCAGTGTTATCCAGTGCTGCCCGCCATTAAGATTAAGCGCACACATCGGCCATCCT

Full Affymetrix probeset data:

Annotations for 1623161_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720