FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623163_at:

>probe:Drosophila_2:1623163_at:636:655; Interrogation_Position=1016; Antisense; TAATAAGATTTCCAGCTCCGAGCAA
>probe:Drosophila_2:1623163_at:157:119; Interrogation_Position=1029; Antisense; AGCTCCGAGCAAAGTCCCGATTGAA
>probe:Drosophila_2:1623163_at:58:465; Interrogation_Position=1047; Antisense; GATTGAAGTTATCCTTATCCCCTCA
>probe:Drosophila_2:1623163_at:235:243; Interrogation_Position=1085; Antisense; AATTCCTTCCGGATGTCAGGGTCAA
>probe:Drosophila_2:1623163_at:356:673; Interrogation_Position=1158; Antisense; TACCCGACTGAGCATTTCGAGCCAA
>probe:Drosophila_2:1623163_at:447:685; Interrogation_Position=1206; Antisense; TATAAACTTATCCTGCGTACTGTCA
>probe:Drosophila_2:1623163_at:259:705; Interrogation_Position=1334; Antisense; TTATGATTAACATTCCTCCCACACA
>probe:Drosophila_2:1623163_at:707:155; Interrogation_Position=1356; Antisense; ACACCCCAACGTATTGATCTTCAAG
>probe:Drosophila_2:1623163_at:205:141; Interrogation_Position=1383; Antisense; ACGGCTCAAGTTAGTTTATCGCAAG
>probe:Drosophila_2:1623163_at:723:555; Interrogation_Position=829; Antisense; GGAATTTATTTTGCACCCCACTTGT
>probe:Drosophila_2:1623163_at:722:245; Interrogation_Position=858; Antisense; AATTGCATTTGGCTGCTTTCGGTCC
>probe:Drosophila_2:1623163_at:110:87; Interrogation_Position=887; Antisense; AGTGCCTTAGTTCCTTAGTTTTGCG
>probe:Drosophila_2:1623163_at:450:351; Interrogation_Position=950; Antisense; GCAGCTTAAAGTTGCTCGAGTCCCC
>probe:Drosophila_2:1623163_at:461:433; Interrogation_Position=993; Antisense; GAGTGAACATGCTTCGTTGGCTTTA

Paste this into a BLAST search page for me
TAATAAGATTTCCAGCTCCGAGCAAAGCTCCGAGCAAAGTCCCGATTGAAGATTGAAGTTATCCTTATCCCCTCAAATTCCTTCCGGATGTCAGGGTCAATACCCGACTGAGCATTTCGAGCCAATATAAACTTATCCTGCGTACTGTCATTATGATTAACATTCCTCCCACACAACACCCCAACGTATTGATCTTCAAGACGGCTCAAGTTAGTTTATCGCAAGGGAATTTATTTTGCACCCCACTTGTAATTGCATTTGGCTGCTTTCGGTCCAGTGCCTTAGTTCCTTAGTTTTGCGGCAGCTTAAAGTTGCTCGAGTCCCCGAGTGAACATGCTTCGTTGGCTTTA

Full Affymetrix probeset data:

Annotations for 1623163_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720