FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623165_at:

>probe:Drosophila_2:1623165_at:641:33; Interrogation_Position=1137; Antisense; ATCACCCTGATACGCCTGAACTAAG
>probe:Drosophila_2:1623165_at:149:465; Interrogation_Position=1169; Antisense; GATTGGCATTATTCTTAGTCAGCTA
>probe:Drosophila_2:1623165_at:226:213; Interrogation_Position=1200; Antisense; AAGAGAACAGCTACCGCTCCGGGAT
>probe:Drosophila_2:1623165_at:411:289; Interrogation_Position=1219; Antisense; CGGGATGGTCATCTTATCGGTGTTA
>probe:Drosophila_2:1623165_at:317:641; Interrogation_Position=683; Antisense; TCTGGCGGTCGGTAACACTCTGGTG
>probe:Drosophila_2:1623165_at:647:529; Interrogation_Position=722; Antisense; GGGATATGCCTGTGCCTCGAACCTA
>probe:Drosophila_2:1623165_at:428:669; Interrogation_Position=745; Antisense; TACTGCCCGGTGTTTACTCCGATGT
>probe:Drosophila_2:1623165_at:270:63; Interrogation_Position=766; Antisense; ATGTGCCCGCTTTGCGAAAGTGGAT
>probe:Drosophila_2:1623165_at:541:221; Interrogation_Position=783; Antisense; AAGTGGATCCTGAATGCAAGCGAAA
>probe:Drosophila_2:1623165_at:463:413; Interrogation_Position=839; Antisense; GACCGGCATACTAGACTGGCATACT
>probe:Drosophila_2:1623165_at:95:393; Interrogation_Position=886; Antisense; GAAATCAAAAAGCTTCCCATCTGCC
>probe:Drosophila_2:1623165_at:599:301; Interrogation_Position=901; Antisense; CCCATCTGCCCATCTAATTGTTAAT
>probe:Drosophila_2:1623165_at:337:469; Interrogation_Position=972; Antisense; GTTGCTTTCTCAAGTCTTTTAGCCA
>probe:Drosophila_2:1623165_at:644:125; Interrogation_Position=992; Antisense; AGCCAATCTATGGTGTCTCAGAAAA

Paste this into a BLAST search page for me
ATCACCCTGATACGCCTGAACTAAGGATTGGCATTATTCTTAGTCAGCTAAAGAGAACAGCTACCGCTCCGGGATCGGGATGGTCATCTTATCGGTGTTATCTGGCGGTCGGTAACACTCTGGTGGGGATATGCCTGTGCCTCGAACCTATACTGCCCGGTGTTTACTCCGATGTATGTGCCCGCTTTGCGAAAGTGGATAAGTGGATCCTGAATGCAAGCGAAAGACCGGCATACTAGACTGGCATACTGAAATCAAAAAGCTTCCCATCTGCCCCCATCTGCCCATCTAATTGTTAATGTTGCTTTCTCAAGTCTTTTAGCCAAGCCAATCTATGGTGTCTCAGAAAA

Full Affymetrix probeset data:

Annotations for 1623165_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720