Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623166_at:

>probe:Drosophila_2:1623166_at:624:105; Interrogation_Position=2327; Antisense; AGAAATCTAGCTCATCCATTCCGGA
>probe:Drosophila_2:1623166_at:317:11; Interrogation_Position=2356; Antisense; ATTCGGGAAATCGTGCTCTGCAGGG
>probe:Drosophila_2:1623166_at:445:483; Interrogation_Position=2459; Antisense; GTATCCTTCTAAATTCTCTCAGCTG
>probe:Drosophila_2:1623166_at:140:109; Interrogation_Position=2507; Antisense; AGAAGTTGCTCAGCTGGGCGCTTGA
>probe:Drosophila_2:1623166_at:218:199; Interrogation_Position=2550; Antisense; AACGATGACAGCCAGTCTTCTGAGC
>probe:Drosophila_2:1623166_at:711:609; Interrogation_Position=2570; Antisense; TGAGCGCCGTTTTGAGATCCCCATT
>probe:Drosophila_2:1623166_at:19:309; Interrogation_Position=2590; Antisense; CCATTGGGCTACTATGTGGGCAAAC
>probe:Drosophila_2:1623166_at:462:525; Interrogation_Position=2607; Antisense; GGGCAAACAGTTTCTCATTGACCAT
>probe:Drosophila_2:1623166_at:566:693; Interrogation_Position=2670; Antisense; TTTGACCCCGTTTATCAATGCGATG
>probe:Drosophila_2:1623166_at:428:183; Interrogation_Position=2700; Antisense; AAAAGCTGAATTTTCGGCGCTGAAC
>probe:Drosophila_2:1623166_at:519:293; Interrogation_Position=2724; Antisense; CGATCATTTGCATAGGAACCTTCCA
>probe:Drosophila_2:1623166_at:179:271; Interrogation_Position=2747; Antisense; CATCCTCAATGGTTTCTGGCTTATC
>probe:Drosophila_2:1623166_at:223:641; Interrogation_Position=2761; Antisense; TCTGGCTTATCATCCACGTTGGAGT
>probe:Drosophila_2:1623166_at:403:179; Interrogation_Position=2874; Antisense; AAACAGTTCTGATTCGGACTCCAAT

Paste this into a BLAST search page for me
AGAAATCTAGCTCATCCATTCCGGAATTCGGGAAATCGTGCTCTGCAGGGGTATCCTTCTAAATTCTCTCAGCTGAGAAGTTGCTCAGCTGGGCGCTTGAAACGATGACAGCCAGTCTTCTGAGCTGAGCGCCGTTTTGAGATCCCCATTCCATTGGGCTACTATGTGGGCAAACGGGCAAACAGTTTCTCATTGACCATTTTGACCCCGTTTATCAATGCGATGAAAAGCTGAATTTTCGGCGCTGAACCGATCATTTGCATAGGAACCTTCCACATCCTCAATGGTTTCTGGCTTATCTCTGGCTTATCATCCACGTTGGAGTAAACAGTTCTGATTCGGACTCCAAT

Full Affymetrix probeset data:

Annotations for 1623166_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime