FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623168_at:

>probe:Drosophila_2:1623168_at:562:217; Interrogation_Position=1186; Antisense; AAGTATGGAGGACCCTGCATGCACT
>probe:Drosophila_2:1623168_at:326:291; Interrogation_Position=1220; Antisense; CGGGCATGCACTACGTTGGCACGGA
>probe:Drosophila_2:1623168_at:396:131; Interrogation_Position=1312; Antisense; ACCGTCGCACTGGAAACCAACGAGA
>probe:Drosophila_2:1623168_at:38:163; Interrogation_Position=1442; Antisense; ACAATCATCACCATCGCATGCCGAT
>probe:Drosophila_2:1623168_at:301:627; Interrogation_Position=1460; Antisense; TGCCGATGCGAGTTTCGACCACGAA
>probe:Drosophila_2:1623168_at:376:511; Interrogation_Position=1487; Antisense; GTGATAGCAAGACCGCCAAGACCCT
>probe:Drosophila_2:1623168_at:528:303; Interrogation_Position=1509; Antisense; CCTGACTATTGTGATGGGCGGCCTA
>probe:Drosophila_2:1623168_at:605:63; Interrogation_Position=1522; Antisense; ATGGGCGGCCTAATTGCTTGCTGGC
>probe:Drosophila_2:1623168_at:631:307; Interrogation_Position=1550; Antisense; CCTTCTTCGTCTATTATCTGCTGAT
>probe:Drosophila_2:1623168_at:271:637; Interrogation_Position=1601; Antisense; TCGAGGACCTCATGTTCGGCTTCAC
>probe:Drosophila_2:1623168_at:93:343; Interrogation_Position=1619; Antisense; GCTTCACCTGGATTGGCTGGGTCAA
>probe:Drosophila_2:1623168_at:663:729; Interrogation_Position=1631; Antisense; TTGGCTGGGTCAACTGCGCCATCAA
>probe:Drosophila_2:1623168_at:260:715; Interrogation_Position=1672; Antisense; TTCTACAATCCGGACTTTCGCACTG
>probe:Drosophila_2:1623168_at:653:19; Interrogation_Position=1723; Antisense; ATTTGCAAGCAGAAGCGTCCGCCCA

Paste this into a BLAST search page for me
AAGTATGGAGGACCCTGCATGCACTCGGGCATGCACTACGTTGGCACGGAACCGTCGCACTGGAAACCAACGAGAACAATCATCACCATCGCATGCCGATTGCCGATGCGAGTTTCGACCACGAAGTGATAGCAAGACCGCCAAGACCCTCCTGACTATTGTGATGGGCGGCCTAATGGGCGGCCTAATTGCTTGCTGGCCCTTCTTCGTCTATTATCTGCTGATTCGAGGACCTCATGTTCGGCTTCACGCTTCACCTGGATTGGCTGGGTCAATTGGCTGGGTCAACTGCGCCATCAATTCTACAATCCGGACTTTCGCACTGATTTGCAAGCAGAAGCGTCCGCCCA

Full Affymetrix probeset data:

Annotations for 1623168_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720