FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623169_at:

>probe:Drosophila_2:1623169_at:157:673; Interrogation_Position=1006; Antisense; TACGCCTCGCAGCAACAGAGATCAT
>probe:Drosophila_2:1623169_at:243:77; Interrogation_Position=1043; Antisense; AGGAGGAGTTCCAGCACCAGCTGTT
>probe:Drosophila_2:1623169_at:261:451; Interrogation_Position=1100; Antisense; GATCGGACTATGACGCGTTAAGCTT
>probe:Drosophila_2:1623169_at:554:273; Interrogation_Position=546; Antisense; CTTGGCGCATCCCAGTCAGGTACAG
>probe:Drosophila_2:1623169_at:165:265; Interrogation_Position=558; Antisense; CAGTCAGGTACAGCCGCAGCATACG
>probe:Drosophila_2:1623169_at:36:29; Interrogation_Position=578; Antisense; ATACGCCGCAGTCGCATTCGCAACA
>probe:Drosophila_2:1623169_at:526:351; Interrogation_Position=621; Antisense; GCAGCAACATCTTATGCCGCAACAA
>probe:Drosophila_2:1623169_at:280:187; Interrogation_Position=692; Antisense; AACAACACTCGCAGCAATTTGCGGC
>probe:Drosophila_2:1623169_at:683:79; Interrogation_Position=755; Antisense; AGGTGCAGCAATCGTACCACGCCCA
>probe:Drosophila_2:1623169_at:200:617; Interrogation_Position=845; Antisense; TGCAACATCAGCATGGCCAGTCAGT
>probe:Drosophila_2:1623169_at:601:265; Interrogation_Position=874; Antisense; CAGATGGGCGGCTACCAGAAGCCAC
>probe:Drosophila_2:1623169_at:719:635; Interrogation_Position=909; Antisense; TCGCAACCTGACCATCAGCGGTGGT
>probe:Drosophila_2:1623169_at:584:121; Interrogation_Position=925; Antisense; AGCGGTGGTCATGCGATGGACTCCA
>probe:Drosophila_2:1623169_at:338:441; Interrogation_Position=939; Antisense; GATGGACTCCAGTGCCTACAGCCAG

Paste this into a BLAST search page for me
TACGCCTCGCAGCAACAGAGATCATAGGAGGAGTTCCAGCACCAGCTGTTGATCGGACTATGACGCGTTAAGCTTCTTGGCGCATCCCAGTCAGGTACAGCAGTCAGGTACAGCCGCAGCATACGATACGCCGCAGTCGCATTCGCAACAGCAGCAACATCTTATGCCGCAACAAAACAACACTCGCAGCAATTTGCGGCAGGTGCAGCAATCGTACCACGCCCATGCAACATCAGCATGGCCAGTCAGTCAGATGGGCGGCTACCAGAAGCCACTCGCAACCTGACCATCAGCGGTGGTAGCGGTGGTCATGCGATGGACTCCAGATGGACTCCAGTGCCTACAGCCAG

Full Affymetrix probeset data:

Annotations for 1623169_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720