FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623175_at:

>probe:Drosophila_2:1623175_at:662:411; Interrogation_Position=105; Antisense; GACCCACTCTCTACGTGAGCATGGA
>probe:Drosophila_2:1623175_at:360:67; Interrogation_Position=125; Antisense; ATGGACAGCTCGCATGCGCAGTTCG
>probe:Drosophila_2:1623175_at:568:717; Interrogation_Position=146; Antisense; TTCGTGCGGGACACAATCAGCGGCA
>probe:Drosophila_2:1623175_at:632:35; Interrogation_Position=182; Antisense; ATCTTTAGCAAGAGCTACTGCCCCT
>probe:Drosophila_2:1623175_at:161:441; Interrogation_Position=281; Antisense; GATGGCAACGAGATCCAGGCGGTTC
>probe:Drosophila_2:1623175_at:600:627; Interrogation_Position=294; Antisense; TCCAGGCGGTTCTTGGCGAGATGAC
>probe:Drosophila_2:1623175_at:296:445; Interrogation_Position=313; Antisense; GATGACGGGCTCGAGGACCGTTCCA
>probe:Drosophila_2:1623175_at:689:469; Interrogation_Position=332; Antisense; GTTCCACGTTGCTTCATCGATGGCA
>probe:Drosophila_2:1623175_at:33:329; Interrogation_Position=369; Antisense; GCGGCACCGACGTGAAGCGGCTATA
>probe:Drosophila_2:1623175_at:468:121; Interrogation_Position=384; Antisense; AGCGGCTATACGAACAGGGCATACT
>probe:Drosophila_2:1623175_at:205:699; Interrogation_Position=418; Antisense; TTTTCAGTGAAAAGTGGGCCGACCT
>probe:Drosophila_2:1623175_at:57:579; Interrogation_Position=434; Antisense; GGCCGACCTATGATCTTACATTTGC
>probe:Drosophila_2:1623175_at:533:19; Interrogation_Position=453; Antisense; ATTTGCTTTTCTTGCTCTGCAGTAA
>probe:Drosophila_2:1623175_at:240:9; Interrogation_Position=72; Antisense; ATTCCATGGGTACGGTGGTCAGCAC

Paste this into a BLAST search page for me
GACCCACTCTCTACGTGAGCATGGAATGGACAGCTCGCATGCGCAGTTCGTTCGTGCGGGACACAATCAGCGGCAATCTTTAGCAAGAGCTACTGCCCCTGATGGCAACGAGATCCAGGCGGTTCTCCAGGCGGTTCTTGGCGAGATGACGATGACGGGCTCGAGGACCGTTCCAGTTCCACGTTGCTTCATCGATGGCAGCGGCACCGACGTGAAGCGGCTATAAGCGGCTATACGAACAGGGCATACTTTTTCAGTGAAAAGTGGGCCGACCTGGCCGACCTATGATCTTACATTTGCATTTGCTTTTCTTGCTCTGCAGTAAATTCCATGGGTACGGTGGTCAGCAC

Full Affymetrix probeset data:

Annotations for 1623175_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720