Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623176_at:

>probe:Drosophila_2:1623176_at:294:591; Interrogation_Position=1202; Antisense; TGGTATCCAAACTTCATGCCACGAA
>probe:Drosophila_2:1623176_at:546:169; Interrogation_Position=1242; Antisense; AAAGGCATCGCCTGCAAGGAAACCA
>probe:Drosophila_2:1623176_at:547:225; Interrogation_Position=1257; Antisense; AAGGAAACCACAGGCTCGACTCAGT
>probe:Drosophila_2:1623176_at:244:335; Interrogation_Position=1270; Antisense; GCTCGACTCAGTCCTGTTAAGGGCA
>probe:Drosophila_2:1623176_at:203:83; Interrogation_Position=1289; Antisense; AGGGCAAGACCATACGCATGCGCAG
>probe:Drosophila_2:1623176_at:644:409; Interrogation_Position=1315; Antisense; GACGAGCTGTTTAGCCGACAGGACA
>probe:Drosophila_2:1623176_at:287:505; Interrogation_Position=1342; Antisense; GTGCCCGTCCACAGGAGGCTTGGAA
>probe:Drosophila_2:1623176_at:377:319; Interrogation_Position=1419; Antisense; GCCGCGACCGGAGCCACAGAAGAAA
>probe:Drosophila_2:1623176_at:698:211; Interrogation_Position=1438; Antisense; AAGAAATATGTTCCGCCAAGGCGCC
>probe:Drosophila_2:1623176_at:159:327; Interrogation_Position=1494; Antisense; GCGAGATCAATCTGGCTCTGTTTTT
>probe:Drosophila_2:1623176_at:704:699; Interrogation_Position=1514; Antisense; TTTTTGACCGCCTTGGCTTCAATAA
>probe:Drosophila_2:1623176_at:407:511; Interrogation_Position=1562; Antisense; GTGAGCCTCATTAAATTTGCCAGTA
>probe:Drosophila_2:1623176_at:572:145; Interrogation_Position=1680; Antisense; ACTCCTGATTGTTTTGAATACCCGA
>probe:Drosophila_2:1623176_at:525:461; Interrogation_Position=1703; Antisense; GATTAGTATCCATCGCAAGCTGTCA

Paste this into a BLAST search page for me
TGGTATCCAAACTTCATGCCACGAAAAAGGCATCGCCTGCAAGGAAACCAAAGGAAACCACAGGCTCGACTCAGTGCTCGACTCAGTCCTGTTAAGGGCAAGGGCAAGACCATACGCATGCGCAGGACGAGCTGTTTAGCCGACAGGACAGTGCCCGTCCACAGGAGGCTTGGAAGCCGCGACCGGAGCCACAGAAGAAAAAGAAATATGTTCCGCCAAGGCGCCGCGAGATCAATCTGGCTCTGTTTTTTTTTTGACCGCCTTGGCTTCAATAAGTGAGCCTCATTAAATTTGCCAGTAACTCCTGATTGTTTTGAATACCCGAGATTAGTATCCATCGCAAGCTGTCA

Full Affymetrix probeset data:

Annotations for 1623176_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime