Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623178_at:

>probe:Drosophila_2:1623178_at:194:169; Interrogation_Position=1447; Antisense; AAATGGTTTGCCGATCAGCAGCCGC
>probe:Drosophila_2:1623178_at:155:657; Interrogation_Position=1476; Antisense; TAAGGAGCCATCATTGCCCTTCAAG
>probe:Drosophila_2:1623178_at:192:357; Interrogation_Position=1529; Antisense; GCAAATCCACTACAAGGCCCAGTAA
>probe:Drosophila_2:1623178_at:489:179; Interrogation_Position=1553; Antisense; AAACATATTTACATCCTGGCAAGCC
>probe:Drosophila_2:1623178_at:304:585; Interrogation_Position=1569; Antisense; TGGCAAGCCCCAAGTATCCAAGCAA
>probe:Drosophila_2:1623178_at:211:49; Interrogation_Position=1584; Antisense; ATCCAAGCAATTTGCAGCTCCAGCT
>probe:Drosophila_2:1623178_at:320:81; Interrogation_Position=1659; Antisense; AGGTGATGCTCCTACTTCACATCCA
>probe:Drosophila_2:1623178_at:144:593; Interrogation_Position=1686; Antisense; TGGTGATCCGGCTCCAGAATCCACT
>probe:Drosophila_2:1623178_at:614:563; Interrogation_Position=1725; Antisense; GGAATCCAATCCAGATCCGGCTCAA
>probe:Drosophila_2:1623178_at:625:673; Interrogation_Position=1815; Antisense; TAGCCCTACGGATCCATTTGATGAG
>probe:Drosophila_2:1623178_at:111:425; Interrogation_Position=1837; Antisense; GAGAGCATGTTTCCACCAATCATTC
>probe:Drosophila_2:1623178_at:660:651; Interrogation_Position=1874; Antisense; TCAAGCGTTCATCCCAGGAGAGGCT
>probe:Drosophila_2:1623178_at:124:337; Interrogation_Position=1896; Antisense; GCTGCGCAAATCTATAATGGCCAAG
>probe:Drosophila_2:1623178_at:563:499; Interrogation_Position=1985; Antisense; GTCTGAACAATGATATGCCGGCGAA

Paste this into a BLAST search page for me
AAATGGTTTGCCGATCAGCAGCCGCTAAGGAGCCATCATTGCCCTTCAAGGCAAATCCACTACAAGGCCCAGTAAAAACATATTTACATCCTGGCAAGCCTGGCAAGCCCCAAGTATCCAAGCAAATCCAAGCAATTTGCAGCTCCAGCTAGGTGATGCTCCTACTTCACATCCATGGTGATCCGGCTCCAGAATCCACTGGAATCCAATCCAGATCCGGCTCAATAGCCCTACGGATCCATTTGATGAGGAGAGCATGTTTCCACCAATCATTCTCAAGCGTTCATCCCAGGAGAGGCTGCTGCGCAAATCTATAATGGCCAAGGTCTGAACAATGATATGCCGGCGAA

Full Affymetrix probeset data:

Annotations for 1623178_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime