Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623179_at:

>probe:Drosophila_2:1623179_at:497:201; Interrogation_Position=1863; Antisense; AACCCCAGCCAAACCTTTGATGAAG
>probe:Drosophila_2:1623179_at:484:371; Interrogation_Position=1884; Antisense; GAAGGGTACCCCAGTTAAGCAGCGA
>probe:Drosophila_2:1623179_at:728:331; Interrogation_Position=1944; Antisense; GCTGGGAGCAAGACTGCCTGGTACA
>probe:Drosophila_2:1623179_at:569:317; Interrogation_Position=1959; Antisense; GCCTGGTACAGTAACGCCTGCTAAA
>probe:Drosophila_2:1623179_at:163:661; Interrogation_Position=1980; Antisense; TAAACCGCAGCGCAAAGGAACTCCT
>probe:Drosophila_2:1623179_at:165:561; Interrogation_Position=1996; Antisense; GGAACTCCTGTGAAGCTCATAAAGC
>probe:Drosophila_2:1623179_at:564:579; Interrogation_Position=2055; Antisense; GGCCAAGGAATCTCCCATCAAGCAA
>probe:Drosophila_2:1623179_at:52:225; Interrogation_Position=2138; Antisense; AAGGAACTCCTGTGAGGATTCCCGT
>probe:Drosophila_2:1623179_at:536:541; Interrogation_Position=2153; Antisense; GGATTCCCGTCATCAAAGACTCGAC
>probe:Drosophila_2:1623179_at:194:685; Interrogation_Position=2187; Antisense; TATCCGCTCTATCCTCAGCAAAAAA
>probe:Drosophila_2:1623179_at:510:373; Interrogation_Position=2247; Antisense; GAAGTTTAGCGCGAACGATCCCATT
>probe:Drosophila_2:1623179_at:168:693; Interrogation_Position=2280; Antisense; TTTGAGTCCGCTTGAGAGATGTCCA
>probe:Drosophila_2:1623179_at:307:29; Interrogation_Position=2392; Antisense; ATACGGCGTATTGTTGTGAGCTCTC
>probe:Drosophila_2:1623179_at:110:511; Interrogation_Position=2407; Antisense; GTGAGCTCTCGTAAACCAATTATGA

Paste this into a BLAST search page for me
AACCCCAGCCAAACCTTTGATGAAGGAAGGGTACCCCAGTTAAGCAGCGAGCTGGGAGCAAGACTGCCTGGTACAGCCTGGTACAGTAACGCCTGCTAAATAAACCGCAGCGCAAAGGAACTCCTGGAACTCCTGTGAAGCTCATAAAGCGGCCAAGGAATCTCCCATCAAGCAAAAGGAACTCCTGTGAGGATTCCCGTGGATTCCCGTCATCAAAGACTCGACTATCCGCTCTATCCTCAGCAAAAAAGAAGTTTAGCGCGAACGATCCCATTTTTGAGTCCGCTTGAGAGATGTCCAATACGGCGTATTGTTGTGAGCTCTCGTGAGCTCTCGTAAACCAATTATGA

Full Affymetrix probeset data:

Annotations for 1623179_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime