FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623182_at:

>probe:Drosophila_2:1623182_at:437:133; Interrogation_Position=140; Antisense; ACGCTCCTTGCTGTGGGCGGAAAAC
>probe:Drosophila_2:1623182_at:296:181; Interrogation_Position=160; Antisense; AAAACCCTTGGCTCCGATGGCATCA
>probe:Drosophila_2:1623182_at:146:267; Interrogation_Position=203; Antisense; CAGTTATCCCATGCCGAGCGACGAG
>probe:Drosophila_2:1623182_at:409:107; Interrogation_Position=309; Antisense; AGAAACTGCCGATGCCGGTGTATCG
>probe:Drosophila_2:1623182_at:518:481; Interrogation_Position=328; Antisense; GTATCGCCCAAAGAACGCCTGGTCA
>probe:Drosophila_2:1623182_at:292:391; Interrogation_Position=355; Antisense; GAAACGTGCGTTGTTTGGCCAGAAC
>probe:Drosophila_2:1623182_at:55:109; Interrogation_Position=375; Antisense; AGAACGACTACATCGACATCCTGGG
>probe:Drosophila_2:1623182_at:83:153; Interrogation_Position=390; Antisense; ACATCCTGGGCAACGATCGTCTGCA
>probe:Drosophila_2:1623182_at:400:497; Interrogation_Position=408; Antisense; GTCTGCATCCAGTCAAGGTGCTCTA
>probe:Drosophila_2:1623182_at:583:231; Interrogation_Position=467; Antisense; AATGAGTACCAGGTGCTTCTCCGCA
>probe:Drosophila_2:1623182_at:632:715; Interrogation_Position=483; Antisense; TTCTCCGCAAACGTAAGCTGCTCGA
>probe:Drosophila_2:1623182_at:327:331; Interrogation_Position=499; Antisense; GCTGCTCGAGAAGTCCAAGTATCCC
>probe:Drosophila_2:1623182_at:703:175; Interrogation_Position=557; Antisense; AAACGCATCCTCTACTTGTACAAGT
>probe:Drosophila_2:1623182_at:520:375; Interrogation_Position=598; Antisense; GAAGACGGGCTATTCACATCAGTAA

Paste this into a BLAST search page for me
ACGCTCCTTGCTGTGGGCGGAAAACAAAACCCTTGGCTCCGATGGCATCACAGTTATCCCATGCCGAGCGACGAGAGAAACTGCCGATGCCGGTGTATCGGTATCGCCCAAAGAACGCCTGGTCAGAAACGTGCGTTGTTTGGCCAGAACAGAACGACTACATCGACATCCTGGGACATCCTGGGCAACGATCGTCTGCAGTCTGCATCCAGTCAAGGTGCTCTAAATGAGTACCAGGTGCTTCTCCGCATTCTCCGCAAACGTAAGCTGCTCGAGCTGCTCGAGAAGTCCAAGTATCCCAAACGCATCCTCTACTTGTACAAGTGAAGACGGGCTATTCACATCAGTAA

Full Affymetrix probeset data:

Annotations for 1623182_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720