Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623189_at:

>probe:Drosophila_2:1623189_at:438:143; Interrogation_Position=5855; Antisense; ACTGTACATGTCTATCGATCTGTCG
>probe:Drosophila_2:1623189_at:675:293; Interrogation_Position=5870; Antisense; CGATCTGTCGAAATTCAACGCGATA
>probe:Drosophila_2:1623189_at:145:135; Interrogation_Position=5887; Antisense; ACGCGATACAATACCATATCTTCGA
>probe:Drosophila_2:1623189_at:291:61; Interrogation_Position=5948; Antisense; ATGTATGCGAGAACCGTCGTGGGCA
>probe:Drosophila_2:1623189_at:553:699; Interrogation_Position=5992; Antisense; TTTATCTACGTTTAGCACACCACTC
>probe:Drosophila_2:1623189_at:151:157; Interrogation_Position=6017; Antisense; ACACTCCCGCAGACAAGAGGACAAA
>probe:Drosophila_2:1623189_at:219:691; Interrogation_Position=6070; Antisense; TTTGTTGACCTTATCGCTATTGTAA
>probe:Drosophila_2:1623189_at:252:83; Interrogation_Position=6105; Antisense; AGTACTTGTATCTTAGCTATGCAAC
>probe:Drosophila_2:1623189_at:386:117; Interrogation_Position=6119; Antisense; AGCTATGCAACTTAACACACACACA
>probe:Drosophila_2:1623189_at:537:105; Interrogation_Position=6154; Antisense; AGACAGAGACACATCCACGGAAAGT
>probe:Drosophila_2:1623189_at:655:425; Interrogation_Position=6217; Antisense; GAGATGTTGGGATTCCATGAAACAA
>probe:Drosophila_2:1623189_at:220:181; Interrogation_Position=6236; Antisense; AAACAAATTGTGTGAGCGCTCGAGT
>probe:Drosophila_2:1623189_at:103:417; Interrogation_Position=6249; Antisense; GAGCGCTCGAGTTTTGAGCTGCAGA
>probe:Drosophila_2:1623189_at:641:701; Interrogation_Position=6260; Antisense; TTTTGAGCTGCAGACGGACGTAGAT

Paste this into a BLAST search page for me
ACTGTACATGTCTATCGATCTGTCGCGATCTGTCGAAATTCAACGCGATAACGCGATACAATACCATATCTTCGAATGTATGCGAGAACCGTCGTGGGCATTTATCTACGTTTAGCACACCACTCACACTCCCGCAGACAAGAGGACAAATTTGTTGACCTTATCGCTATTGTAAAGTACTTGTATCTTAGCTATGCAACAGCTATGCAACTTAACACACACACAAGACAGAGACACATCCACGGAAAGTGAGATGTTGGGATTCCATGAAACAAAAACAAATTGTGTGAGCGCTCGAGTGAGCGCTCGAGTTTTGAGCTGCAGATTTTGAGCTGCAGACGGACGTAGAT

Full Affymetrix probeset data:

Annotations for 1623189_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime