Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623190_at:

>probe:Drosophila_2:1623190_at:213:631; Interrogation_Position=1249; Antisense; TCCTCAGGCTTTGATCTCCACATGA
>probe:Drosophila_2:1623190_at:125:575; Interrogation_Position=1311; Antisense; GGCGGATTTCAGTCCAAAGCTTCAG
>probe:Drosophila_2:1623190_at:341:173; Interrogation_Position=1326; Antisense; AAAGCTTCAGGCATCGCAGTGTAAA
>probe:Drosophila_2:1623190_at:683:491; Interrogation_Position=1346; Antisense; GTAAAATGTGCCAATCCCTGTTCTT
>probe:Drosophila_2:1623190_at:584:713; Interrogation_Position=1366; Antisense; TTCTTCCAACTTCCGGCTAACAGAA
>probe:Drosophila_2:1623190_at:5:391; Interrogation_Position=1388; Antisense; GAAACTGTTCTCATGCGGGAATCCG
>probe:Drosophila_2:1623190_at:726:387; Interrogation_Position=1414; Antisense; GAAAAGTGGTGTTCCTGCGAACCCA
>probe:Drosophila_2:1623190_at:347:227; Interrogation_Position=1458; Antisense; AAGGCTCCTCAGAAAAGTGGCTCAA
>probe:Drosophila_2:1623190_at:381:521; Interrogation_Position=1474; Antisense; GTGGCTCAAGAGGTGGTGCATCATA
>probe:Drosophila_2:1623190_at:201:19; Interrogation_Position=1508; Antisense; ATTTGCGGGATCGAAACCTCACTAC
>probe:Drosophila_2:1623190_at:235:131; Interrogation_Position=1523; Antisense; ACCTCACTACGCTTTGCCAGAATTA
>probe:Drosophila_2:1623190_at:386:119; Interrogation_Position=1616; Antisense; AGCTGCACACCTACATAATCACATT
>probe:Drosophila_2:1623190_at:402:173; Interrogation_Position=1643; Antisense; AAACCAATCCGAGTTCAGCGCATTT
>probe:Drosophila_2:1623190_at:683:123; Interrogation_Position=1659; Antisense; AGCGCATTTCGAGGCCACTGTACAG

Paste this into a BLAST search page for me
TCCTCAGGCTTTGATCTCCACATGAGGCGGATTTCAGTCCAAAGCTTCAGAAAGCTTCAGGCATCGCAGTGTAAAGTAAAATGTGCCAATCCCTGTTCTTTTCTTCCAACTTCCGGCTAACAGAAGAAACTGTTCTCATGCGGGAATCCGGAAAAGTGGTGTTCCTGCGAACCCAAAGGCTCCTCAGAAAAGTGGCTCAAGTGGCTCAAGAGGTGGTGCATCATAATTTGCGGGATCGAAACCTCACTACACCTCACTACGCTTTGCCAGAATTAAGCTGCACACCTACATAATCACATTAAACCAATCCGAGTTCAGCGCATTTAGCGCATTTCGAGGCCACTGTACAG

Full Affymetrix probeset data:

Annotations for 1623190_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime