FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623191_at:

>probe:Drosophila_2:1623191_at:257:221; Interrogation_Position=1004; Antisense; AAGTGTTCGGCCAGAAGCGCAACGC
>probe:Drosophila_2:1623191_at:543:313; Interrogation_Position=1038; Antisense; GCCAGCCACCAATTATCGGCTATGA
>probe:Drosophila_2:1623191_at:191:553; Interrogation_Position=1074; Antisense; GGAGCTGTCAGGAAACTTACGCTTA
>probe:Drosophila_2:1623191_at:666:289; Interrogation_Position=1118; Antisense; CGGGTTGACCTTCAGATTCAATGCA
>probe:Drosophila_2:1623191_at:619:13; Interrogation_Position=1133; Antisense; ATTCAATGCATTCCAGTCCGCGGAG
>probe:Drosophila_2:1623191_at:81:417; Interrogation_Position=1164; Antisense; GAGCTTCAGACCGAAAGGCAACCCA
>probe:Drosophila_2:1623191_at:205:49; Interrogation_Position=1188; Antisense; ATCCACCCAATGTTGATGGCTGTAG
>probe:Drosophila_2:1623191_at:179:627; Interrogation_Position=1222; Antisense; TGCCTCGTTGTGGTTGATATTCTAA
>probe:Drosophila_2:1623191_at:383:527; Interrogation_Position=1247; Antisense; GGGAACTATGCTTCACAGCGAGCTA
>probe:Drosophila_2:1623191_at:544:545; Interrogation_Position=1301; Antisense; GGATCTCCATTTTTACTTGCTATGC
>probe:Drosophila_2:1623191_at:632:115; Interrogation_Position=1414; Antisense; AGCTTTACCATAACCAAGTGTCTTG
>probe:Drosophila_2:1623191_at:242:81; Interrogation_Position=1458; Antisense; AGGTGTCTAATGTACTACGCATAAG
>probe:Drosophila_2:1623191_at:330:5; Interrogation_Position=1520; Antisense; ATTGCATAATTTCGGAGTGCCTTAA
>probe:Drosophila_2:1623191_at:504:431; Interrogation_Position=1534; Antisense; GAGTGCCTTAAGTGTGTTTATCTGA

Paste this into a BLAST search page for me
AAGTGTTCGGCCAGAAGCGCAACGCGCCAGCCACCAATTATCGGCTATGAGGAGCTGTCAGGAAACTTACGCTTACGGGTTGACCTTCAGATTCAATGCAATTCAATGCATTCCAGTCCGCGGAGGAGCTTCAGACCGAAAGGCAACCCAATCCACCCAATGTTGATGGCTGTAGTGCCTCGTTGTGGTTGATATTCTAAGGGAACTATGCTTCACAGCGAGCTAGGATCTCCATTTTTACTTGCTATGCAGCTTTACCATAACCAAGTGTCTTGAGGTGTCTAATGTACTACGCATAAGATTGCATAATTTCGGAGTGCCTTAAGAGTGCCTTAAGTGTGTTTATCTGA

Full Affymetrix probeset data:

Annotations for 1623191_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720