FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623193_at:

>probe:Drosophila_2:1623193_at:302:387; Interrogation_Position=3241; Antisense; GAACACACTGGATCTTGATGTCTTG
>probe:Drosophila_2:1623193_at:461:657; Interrogation_Position=3271; Antisense; TAAGTACACCGATGATCCGTCAGCG
>probe:Drosophila_2:1623193_at:307:495; Interrogation_Position=3289; Antisense; GTCAGCGCCGGAGAAAACTCGTGAA
>probe:Drosophila_2:1623193_at:262:193; Interrogation_Position=3304; Antisense; AACTCGTGAAGAAGTGCGTCCCGGC
>probe:Drosophila_2:1623193_at:458:713; Interrogation_Position=3335; Antisense; TTCATCAGCTTTTCAGTGGCCCCAA
>probe:Drosophila_2:1623193_at:263:267; Interrogation_Position=3348; Antisense; CAGTGGCCCCAAATGTGAGCGTTGA
>probe:Drosophila_2:1623193_at:380:417; Interrogation_Position=3364; Antisense; GAGCGTTGAGCTCACGAATCCTATC
>probe:Drosophila_2:1623193_at:119:637; Interrogation_Position=3395; Antisense; TCGTCGCTTTTCCAGGTCAACACTG
>probe:Drosophila_2:1623193_at:418:495; Interrogation_Position=3410; Antisense; GTCAACACTGTCATATCCGAGGGAG
>probe:Drosophila_2:1623193_at:475:399; Interrogation_Position=3434; Antisense; GACACGGTCCAATCTCTGCGAGAGA
>probe:Drosophila_2:1623193_at:727:175; Interrogation_Position=3483; Antisense; AAACGGATGCGGCTACCCTTAAGAT
>probe:Drosophila_2:1623193_at:335:3; Interrogation_Position=3506; Antisense; ATCTGGCGGTATGAGGATCCCGTTC
>probe:Drosophila_2:1623193_at:98:667; Interrogation_Position=3582; Antisense; TACTCGGCGAGGGAAACTTCGTTCT
>probe:Drosophila_2:1623193_at:270:61; Interrogation_Position=3774; Antisense; ATGTACTGTGAGTTGGTTGTGCCCA

Paste this into a BLAST search page for me
GAACACACTGGATCTTGATGTCTTGTAAGTACACCGATGATCCGTCAGCGGTCAGCGCCGGAGAAAACTCGTGAAAACTCGTGAAGAAGTGCGTCCCGGCTTCATCAGCTTTTCAGTGGCCCCAACAGTGGCCCCAAATGTGAGCGTTGAGAGCGTTGAGCTCACGAATCCTATCTCGTCGCTTTTCCAGGTCAACACTGGTCAACACTGTCATATCCGAGGGAGGACACGGTCCAATCTCTGCGAGAGAAAACGGATGCGGCTACCCTTAAGATATCTGGCGGTATGAGGATCCCGTTCTACTCGGCGAGGGAAACTTCGTTCTATGTACTGTGAGTTGGTTGTGCCCA

Full Affymetrix probeset data:

Annotations for 1623193_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720