FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623194_at:

>probe:Drosophila_2:1623194_at:10:649; Interrogation_Position=116; Antisense; TCATCCAGCACGTTTTTCACCGGAG
>probe:Drosophila_2:1623194_at:15:265; Interrogation_Position=121; Antisense; CAGCACGTTTTTCACCGGAGGATAA
>probe:Drosophila_2:1623194_at:83:435; Interrogation_Position=138; Antisense; GAGGATAAGTACTCCCGCCAGAGGC
>probe:Drosophila_2:1623194_at:668:89; Interrogation_Position=145; Antisense; AGTACTCCCGCCAGAGGCTGACCAT
>probe:Drosophila_2:1623194_at:287:109; Interrogation_Position=172; Antisense; AGAAGCGCTTTGGACTGCTGCTCAC
>probe:Drosophila_2:1623194_at:510:405; Interrogation_Position=184; Antisense; GACTGCTGCTCACCCAGAAGCCGGA
>probe:Drosophila_2:1623194_at:645:553; Interrogation_Position=206; Antisense; GGAGCCCATTTACTAAGCCGCATTT
>probe:Drosophila_2:1623194_at:350:123; Interrogation_Position=221; Antisense; AGCCGCATTTTAGTTTTAATTAGTG
>probe:Drosophila_2:1623194_at:696:483; Interrogation_Position=29; Antisense; GTATCTGATGTACACAATTAACGAA
>probe:Drosophila_2:1623194_at:402:247; Interrogation_Position=43; Antisense; CAATTAACGAAAACGGCGATCGCGT
>probe:Drosophila_2:1623194_at:665:325; Interrogation_Position=58; Antisense; GCGATCGCGTTTACACCCTGAAGAA
>probe:Drosophila_2:1623194_at:199:697; Interrogation_Position=67; Antisense; TTTACACCCTGAAGAAACGCACCGA
>probe:Drosophila_2:1623194_at:214:177; Interrogation_Position=81; Antisense; AAACGCACCGAGGATGGTCGTCCCA
>probe:Drosophila_2:1623194_at:456:435; Interrogation_Position=90; Antisense; GAGGATGGTCGTCCCACACTATCTG

Paste this into a BLAST search page for me
TCATCCAGCACGTTTTTCACCGGAGCAGCACGTTTTTCACCGGAGGATAAGAGGATAAGTACTCCCGCCAGAGGCAGTACTCCCGCCAGAGGCTGACCATAGAAGCGCTTTGGACTGCTGCTCACGACTGCTGCTCACCCAGAAGCCGGAGGAGCCCATTTACTAAGCCGCATTTAGCCGCATTTTAGTTTTAATTAGTGGTATCTGATGTACACAATTAACGAACAATTAACGAAAACGGCGATCGCGTGCGATCGCGTTTACACCCTGAAGAATTTACACCCTGAAGAAACGCACCGAAAACGCACCGAGGATGGTCGTCCCAGAGGATGGTCGTCCCACACTATCTG

Full Affymetrix probeset data:

Annotations for 1623194_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720