FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623195_at:

>probe:Drosophila_2:1623195_at:234:677; Interrogation_Position=460; Antisense; TAGACGAGGATAGTGGTGAGCTCCA
>probe:Drosophila_2:1623195_at:10:437; Interrogation_Position=465; Antisense; GAGGATAGTGGTGAGCTCCACGAAA
>probe:Drosophila_2:1623195_at:107:535; Interrogation_Position=474; Antisense; GGTGAGCTCCACGAAAGTAGATTGT
>probe:Drosophila_2:1623195_at:613:335; Interrogation_Position=479; Antisense; GCTCCACGAAAGTAGATTGTTCACA
>probe:Drosophila_2:1623195_at:89:487; Interrogation_Position=490; Antisense; GTAGATTGTTCACAGATCGACGCCA
>probe:Drosophila_2:1623195_at:611:93; Interrogation_Position=492; Antisense; AGATTGTTCACAGATCGACGCCACT
>probe:Drosophila_2:1623195_at:123:527; Interrogation_Position=518; Antisense; GGGACGGGCTCAACTGTACTTCCAG
>probe:Drosophila_2:1623195_at:697:139; Interrogation_Position=521; Antisense; ACGGGCTCAACTGTACTTCCAGCAG
>probe:Drosophila_2:1623195_at:138:571; Interrogation_Position=524; Antisense; GGCTCAACTGTACTTCCAGCAGTAT
>probe:Drosophila_2:1623195_at:81:601; Interrogation_Position=532; Antisense; TGTACTTCCAGCAGTATCTAGGGAT
>probe:Drosophila_2:1623195_at:523:149; Interrogation_Position=535; Antisense; ACTTCCAGCAGTATCTAGGGATCCA
>probe:Drosophila_2:1623195_at:575:309; Interrogation_Position=539; Antisense; CCAGCAGTATCTAGGGATCCAGCAC
>probe:Drosophila_2:1623195_at:21:351; Interrogation_Position=542; Antisense; GCAGTATCTAGGGATCCAGCACCGC
>probe:Drosophila_2:1623195_at:536:483; Interrogation_Position=545; Antisense; GTATCTAGGGATCCAGCACCGCCAT

Paste this into a BLAST search page for me
TAGACGAGGATAGTGGTGAGCTCCAGAGGATAGTGGTGAGCTCCACGAAAGGTGAGCTCCACGAAAGTAGATTGTGCTCCACGAAAGTAGATTGTTCACAGTAGATTGTTCACAGATCGACGCCAAGATTGTTCACAGATCGACGCCACTGGGACGGGCTCAACTGTACTTCCAGACGGGCTCAACTGTACTTCCAGCAGGGCTCAACTGTACTTCCAGCAGTATTGTACTTCCAGCAGTATCTAGGGATACTTCCAGCAGTATCTAGGGATCCACCAGCAGTATCTAGGGATCCAGCACGCAGTATCTAGGGATCCAGCACCGCGTATCTAGGGATCCAGCACCGCCAT

Full Affymetrix probeset data:

Annotations for 1623195_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720