Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623200_at:

>probe:Drosophila_2:1623200_at:637:429; Interrogation_Position=1455; Antisense; GATGAACTGGTTGATCCCGATCCGA
>probe:Drosophila_2:1623200_at:60:49; Interrogation_Position=1491; Antisense; ATCCTATTTGGCTGTTGCAGGCGCA
>probe:Drosophila_2:1623200_at:166:499; Interrogation_Position=1517; Antisense; GTCTGCACTGGGTCGGTTGTGAACC
>probe:Drosophila_2:1623200_at:156:495; Interrogation_Position=1554; Antisense; GTCAAAATCAAATCTCGCCACTGTG
>probe:Drosophila_2:1623200_at:279:673; Interrogation_Position=1642; Antisense; TACGCTGGACAGATGTGCTTCCTAA
>probe:Drosophila_2:1623200_at:253:241; Interrogation_Position=1677; Antisense; AATACTGTAGCTGTAGGTCTTGCAA
>probe:Drosophila_2:1623200_at:443:485; Interrogation_Position=1689; Antisense; GTAGGTCTTGCAATTCCAACACTTC
>probe:Drosophila_2:1623200_at:181:219; Interrogation_Position=1715; Antisense; AAGTGCTTCCCTATAGCGTTACACG
>probe:Drosophila_2:1623200_at:434:119; Interrogation_Position=1729; Antisense; AGCGTTACACGCGATTCTTCCAATC
>probe:Drosophila_2:1623200_at:176:641; Interrogation_Position=1744; Antisense; TCTTCCAATCGGCTTAGTGCGTAGT
>probe:Drosophila_2:1623200_at:204:537; Interrogation_Position=1778; Antisense; GGTCTAGTCTACGTTTAAGTTATCT
>probe:Drosophila_2:1623200_at:482:95; Interrogation_Position=1804; Antisense; AGATTCAGAGAGACCGCTTGACCCT
>probe:Drosophila_2:1623200_at:437:609; Interrogation_Position=1822; Antisense; TGACCCTCTGCTGTGTAATACTGTA
>probe:Drosophila_2:1623200_at:245:349; Interrogation_Position=1849; Antisense; GCAGTCTAATGTTTGCCTAATCTAG

Paste this into a BLAST search page for me
GATGAACTGGTTGATCCCGATCCGAATCCTATTTGGCTGTTGCAGGCGCAGTCTGCACTGGGTCGGTTGTGAACCGTCAAAATCAAATCTCGCCACTGTGTACGCTGGACAGATGTGCTTCCTAAAATACTGTAGCTGTAGGTCTTGCAAGTAGGTCTTGCAATTCCAACACTTCAAGTGCTTCCCTATAGCGTTACACGAGCGTTACACGCGATTCTTCCAATCTCTTCCAATCGGCTTAGTGCGTAGTGGTCTAGTCTACGTTTAAGTTATCTAGATTCAGAGAGACCGCTTGACCCTTGACCCTCTGCTGTGTAATACTGTAGCAGTCTAATGTTTGCCTAATCTAG

Full Affymetrix probeset data:

Annotations for 1623200_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime