FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623201_at:

>probe:Drosophila_2:1623201_at:8:151; Interrogation_Position=369; Antisense; ACATTGGTGCCCTGGATAGTCTGGT
>probe:Drosophila_2:1623201_at:687:267; Interrogation_Position=421; Antisense; CAGGGACTGCACGAATTTGTTTTTT
>probe:Drosophila_2:1623201_at:265:613; Interrogation_Position=471; Antisense; TGAAAGTCGAACCTCCATCTGGATT
>probe:Drosophila_2:1623201_at:99:517; Interrogation_Position=513; Antisense; GTGTGGCAGATGCTCCATTGGTTAA
>probe:Drosophila_2:1623201_at:451:539; Interrogation_Position=532; Antisense; GGTTAACGCAGAGTGGCCCAATCAT
>probe:Drosophila_2:1623201_at:476:433; Interrogation_Position=560; Antisense; GAGGGATCTTTGTTCTTCGTAGAAA
>probe:Drosophila_2:1623201_at:121:395; Interrogation_Position=581; Antisense; GAAAGGCAGATTCGCCTGTGCGTCA
>probe:Drosophila_2:1623201_at:446:285; Interrogation_Position=596; Antisense; CTGTGCGTCAGTGTTGGATTGTACC
>probe:Drosophila_2:1623201_at:150:375; Interrogation_Position=623; Antisense; GAAGACACCCAGGAACTAGTTGCCT
>probe:Drosophila_2:1623201_at:347:727; Interrogation_Position=674; Antisense; TTGGGCGCCCTGCAAGTCAAAGATA
>probe:Drosophila_2:1623201_at:84:171; Interrogation_Position=692; Antisense; AAAGATACACACAAGCGACGCGGAT
>probe:Drosophila_2:1623201_at:52:527; Interrogation_Position=735; Antisense; GGGAAATAGCATACCGCCTAGCCGT
>probe:Drosophila_2:1623201_at:311:277; Interrogation_Position=752; Antisense; CTAGCCGTCCAAGGTCACGATGTAA
>probe:Drosophila_2:1623201_at:208:287; Interrogation_Position=827; Antisense; CTGGGATTCCAGGTCATCGATCAAT

Paste this into a BLAST search page for me
ACATTGGTGCCCTGGATAGTCTGGTCAGGGACTGCACGAATTTGTTTTTTTGAAAGTCGAACCTCCATCTGGATTGTGTGGCAGATGCTCCATTGGTTAAGGTTAACGCAGAGTGGCCCAATCATGAGGGATCTTTGTTCTTCGTAGAAAGAAAGGCAGATTCGCCTGTGCGTCACTGTGCGTCAGTGTTGGATTGTACCGAAGACACCCAGGAACTAGTTGCCTTTGGGCGCCCTGCAAGTCAAAGATAAAAGATACACACAAGCGACGCGGATGGGAAATAGCATACCGCCTAGCCGTCTAGCCGTCCAAGGTCACGATGTAACTGGGATTCCAGGTCATCGATCAAT

Full Affymetrix probeset data:

Annotations for 1623201_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720