Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623203_at:

>probe:Drosophila_2:1623203_at:395:659; Interrogation_Position=2094; Antisense; TAAGAACTCGTTGAGTCCGCGCAAC
>probe:Drosophila_2:1623203_at:261:303; Interrogation_Position=2110; Antisense; CCGCGCAACTATGATGCACTCGTTA
>probe:Drosophila_2:1623203_at:96:355; Interrogation_Position=2125; Antisense; GCACTCGTTAGCATTTTGGCGACCG
>probe:Drosophila_2:1623203_at:516:725; Interrogation_Position=2140; Antisense; TTGGCGACCGAAGTGACTATTCAAT
>probe:Drosophila_2:1623203_at:356:103; Interrogation_Position=2197; Antisense; AGACTTGGCGGTTTGGTGCTTGATC
>probe:Drosophila_2:1623203_at:279:217; Interrogation_Position=2225; Antisense; AAGTTCGTGCCTTGGGAAGTTATCT
>probe:Drosophila_2:1623203_at:462:151; Interrogation_Position=2251; Antisense; ACAGGAGCTACATCGTGGTCGGTTC
>probe:Drosophila_2:1623203_at:133:483; Interrogation_Position=2291; Antisense; GTATATCCCAAATAGCTACGCTCCT
>probe:Drosophila_2:1623203_at:312:141; Interrogation_Position=2332; Antisense; ACGGAGCTATCGGAGTACTGGAATC
>probe:Drosophila_2:1623203_at:268:725; Interrogation_Position=2382; Antisense; TTGGCATCTCACACCTAACGAAGTT
>probe:Drosophila_2:1623203_at:26:179; Interrogation_Position=2474; Antisense; AAACATCGTATTCATGCGGACGTAT
>probe:Drosophila_2:1623203_at:63:331; Interrogation_Position=2489; Antisense; GCGGACGTATTATGACTGGCACTGA
>probe:Drosophila_2:1623203_at:534:207; Interrogation_Position=2539; Antisense; AAGCAGCTGCGAAAGCGGACCCAAA
>probe:Drosophila_2:1623203_at:374:455; Interrogation_Position=2596; Antisense; GATAAGGCTCGCAATTTGAACACCA

Paste this into a BLAST search page for me
TAAGAACTCGTTGAGTCCGCGCAACCCGCGCAACTATGATGCACTCGTTAGCACTCGTTAGCATTTTGGCGACCGTTGGCGACCGAAGTGACTATTCAATAGACTTGGCGGTTTGGTGCTTGATCAAGTTCGTGCCTTGGGAAGTTATCTACAGGAGCTACATCGTGGTCGGTTCGTATATCCCAAATAGCTACGCTCCTACGGAGCTATCGGAGTACTGGAATCTTGGCATCTCACACCTAACGAAGTTAAACATCGTATTCATGCGGACGTATGCGGACGTATTATGACTGGCACTGAAAGCAGCTGCGAAAGCGGACCCAAAGATAAGGCTCGCAATTTGAACACCA

Full Affymetrix probeset data:

Annotations for 1623203_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime