Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623204_at:

>probe:Drosophila_2:1623204_at:40:25; Interrogation_Position=335; Antisense; ATATCCACCAGGTATGCGTCCATGT
>probe:Drosophila_2:1623204_at:389:589; Interrogation_Position=371; Antisense; TGGATATCCAGAGTTCGAGCACAAT
>probe:Drosophila_2:1623204_at:181:123; Interrogation_Position=448; Antisense; AGCGTTGTGGCTAACTGTCTGCTCT
>probe:Drosophila_2:1623204_at:192:621; Interrogation_Position=467; Antisense; TGCTCTGGGCCATGTTGGATCATAT
>probe:Drosophila_2:1623204_at:65:647; Interrogation_Position=486; Antisense; TCATATGTCGGACTTGGGCCTGGAC
>probe:Drosophila_2:1623204_at:306:501; Interrogation_Position=547; Antisense; GTCGTTGCCGTGGTGAAGCCGCATA
>probe:Drosophila_2:1623204_at:694:493; Interrogation_Position=577; Antisense; GTAATATCCTATTTGCATTCCCTGC
>probe:Drosophila_2:1623204_at:282:533; Interrogation_Position=606; Antisense; GGTGGTCCGTTTGATATCCAGCATC
>probe:Drosophila_2:1623204_at:230:605; Interrogation_Position=635; Antisense; TGATCGGACCATTCAATGCCCAGGG
>probe:Drosophila_2:1623204_at:73:195; Interrogation_Position=665; Antisense; AACTGTGCCAGGAGACCGATGTGCC
>probe:Drosophila_2:1623204_at:164:197; Interrogation_Position=704; Antisense; AACTGGCCAGGGACGATTGTTCGAT
>probe:Drosophila_2:1623204_at:546:677; Interrogation_Position=731; Antisense; TAGTTCGCTGGCTAATCGCGATCGT
>probe:Drosophila_2:1623204_at:585:123; Interrogation_Position=809; Antisense; AGCGCCTGGTGCTTTTGGAGTCCAT
>probe:Drosophila_2:1623204_at:465:263; Interrogation_Position=847; Antisense; CAGCTCTTGCATGGCCATTTGGTTA

Paste this into a BLAST search page for me
ATATCCACCAGGTATGCGTCCATGTTGGATATCCAGAGTTCGAGCACAATAGCGTTGTGGCTAACTGTCTGCTCTTGCTCTGGGCCATGTTGGATCATATTCATATGTCGGACTTGGGCCTGGACGTCGTTGCCGTGGTGAAGCCGCATAGTAATATCCTATTTGCATTCCCTGCGGTGGTCCGTTTGATATCCAGCATCTGATCGGACCATTCAATGCCCAGGGAACTGTGCCAGGAGACCGATGTGCCAACTGGCCAGGGACGATTGTTCGATTAGTTCGCTGGCTAATCGCGATCGTAGCGCCTGGTGCTTTTGGAGTCCATCAGCTCTTGCATGGCCATTTGGTTA

Full Affymetrix probeset data:

Annotations for 1623204_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime