Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623207_at:

>probe:Drosophila_2:1623207_at:268:411; Interrogation_Position=1629; Antisense; GACGCGCATACAATACTCATCGACA
>probe:Drosophila_2:1623207_at:390:133; Interrogation_Position=1655; Antisense; ACTCAAGTTGCCACTCGGACGAATG
>probe:Drosophila_2:1623207_at:139:425; Interrogation_Position=1707; Antisense; GAGACGAACTCACAGGCATTGCATT
>probe:Drosophila_2:1623207_at:390:291; Interrogation_Position=1762; Antisense; CGTATCTGTTAAGTACTCCGGGCGA
>probe:Drosophila_2:1623207_at:489:385; Interrogation_Position=1835; Antisense; GAAAATACTCATGCACAGACTCTGA
>probe:Drosophila_2:1623207_at:283:405; Interrogation_Position=1852; Antisense; GACTCTGAATAAGTTCCCCTTTGCA
>probe:Drosophila_2:1623207_at:238:381; Interrogation_Position=1877; Antisense; GAACGCAATTTACTCATCAGTCAGT
>probe:Drosophila_2:1623207_at:453:35; Interrogation_Position=1892; Antisense; ATCAGTCAGTATTCTCTATGGCCAC
>probe:Drosophila_2:1623207_at:170:279; Interrogation_Position=1967; Antisense; CTACTACTTATACTTGTGCTGCCAC
>probe:Drosophila_2:1623207_at:186:467; Interrogation_Position=1994; Antisense; GTTGGGCTGCCGTAGTTGCAGATCA
>probe:Drosophila_2:1623207_at:242:483; Interrogation_Position=2021; Antisense; GTATCCATTGTCCATACATTGCGAG
>probe:Drosophila_2:1623207_at:577:143; Interrogation_Position=2076; Antisense; ACTGTACGTCGTGTTGTATAGCGCT
>probe:Drosophila_2:1623207_at:348:27; Interrogation_Position=2093; Antisense; ATAGCGCTGTAATATCCTGTCACCT
>probe:Drosophila_2:1623207_at:230:285; Interrogation_Position=2109; Antisense; CTGTCACCTGCTTCTGCTTAATTAA

Paste this into a BLAST search page for me
GACGCGCATACAATACTCATCGACAACTCAAGTTGCCACTCGGACGAATGGAGACGAACTCACAGGCATTGCATTCGTATCTGTTAAGTACTCCGGGCGAGAAAATACTCATGCACAGACTCTGAGACTCTGAATAAGTTCCCCTTTGCAGAACGCAATTTACTCATCAGTCAGTATCAGTCAGTATTCTCTATGGCCACCTACTACTTATACTTGTGCTGCCACGTTGGGCTGCCGTAGTTGCAGATCAGTATCCATTGTCCATACATTGCGAGACTGTACGTCGTGTTGTATAGCGCTATAGCGCTGTAATATCCTGTCACCTCTGTCACCTGCTTCTGCTTAATTAA

Full Affymetrix probeset data:

Annotations for 1623207_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime