Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623208_at:

>probe:Drosophila_2:1623208_at:235:635; Interrogation_Position=1445; Antisense; TCGCAGCAGCCGGTAGCGGAGTACT
>probe:Drosophila_2:1623208_at:300:431; Interrogation_Position=1463; Antisense; GAGTACTACGAGCACTTGGGCTACT
>probe:Drosophila_2:1623208_at:679:625; Interrogation_Position=1504; Antisense; TGCCAGCCAGAATCCCAACTTCGGG
>probe:Drosophila_2:1623208_at:458:531; Interrogation_Position=1576; Antisense; GGGTGACCCCGCACCGCAACAGGAG
>probe:Drosophila_2:1623208_at:691:351; Interrogation_Position=1624; Antisense; GCAGCACCAGAATCCATCGCAGCAT
>probe:Drosophila_2:1623208_at:551:567; Interrogation_Position=1658; Antisense; GGCACTTACACTTATGTCAATCCCT
>probe:Drosophila_2:1623208_at:561:493; Interrogation_Position=1673; Antisense; GTCAATCCCTAAGCTACTTCATTTG
>probe:Drosophila_2:1623208_at:571:659; Interrogation_Position=1682; Antisense; TAAGCTACTTCATTTGCACATTTGT
>probe:Drosophila_2:1623208_at:181:357; Interrogation_Position=1697; Antisense; GCACATTTGTTGTCGGGCACAGAGA
>probe:Drosophila_2:1623208_at:428:347; Interrogation_Position=1730; Antisense; GCATCGGTATTCCTAAACTTATTTG
>probe:Drosophila_2:1623208_at:32:569; Interrogation_Position=1779; Antisense; GGCAGAGTTATAAACATTCATCTTT
>probe:Drosophila_2:1623208_at:344:459; Interrogation_Position=1842; Antisense; GATTTGCGATAACTCAATTCCTTTT
>probe:Drosophila_2:1623208_at:392:683; Interrogation_Position=1866; Antisense; TATCTAAATTGGTTGTACCCTTCGG
>probe:Drosophila_2:1623208_at:636:675; Interrogation_Position=1900; Antisense; TAGAATATTTATACCCCACGTTGTT

Paste this into a BLAST search page for me
TCGCAGCAGCCGGTAGCGGAGTACTGAGTACTACGAGCACTTGGGCTACTTGCCAGCCAGAATCCCAACTTCGGGGGGTGACCCCGCACCGCAACAGGAGGCAGCACCAGAATCCATCGCAGCATGGCACTTACACTTATGTCAATCCCTGTCAATCCCTAAGCTACTTCATTTGTAAGCTACTTCATTTGCACATTTGTGCACATTTGTTGTCGGGCACAGAGAGCATCGGTATTCCTAAACTTATTTGGGCAGAGTTATAAACATTCATCTTTGATTTGCGATAACTCAATTCCTTTTTATCTAAATTGGTTGTACCCTTCGGTAGAATATTTATACCCCACGTTGTT

Full Affymetrix probeset data:

Annotations for 1623208_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime