Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623209_at:

>probe:Drosophila_2:1623209_at:653:363; Interrogation_Position=2410; Antisense; GAATCTTTGCTTCCCTATTTAGTCC
>probe:Drosophila_2:1623209_at:619:169; Interrogation_Position=2454; Antisense; AAAGAACCAGCACCGACCAAGTTTG
>probe:Drosophila_2:1623209_at:632:413; Interrogation_Position=2468; Antisense; GACCAAGTTTGGTCCCATCGAGGGA
>probe:Drosophila_2:1623209_at:552:587; Interrogation_Position=2585; Antisense; TGGACCAAAGTTACCGACAGCACCT
>probe:Drosophila_2:1623209_at:74:175; Interrogation_Position=2615; Antisense; AAAGCCGGCTGCTCCAGAGATTCAG
>probe:Drosophila_2:1623209_at:140:399; Interrogation_Position=2658; Antisense; GACAGACTTCAACAGCTTTGGCAGC
>probe:Drosophila_2:1623209_at:467:691; Interrogation_Position=2674; Antisense; TTTGGCAGCAGCACGCGCCTAAAAA
>probe:Drosophila_2:1623209_at:1:213; Interrogation_Position=2724; Antisense; AAGAAATGCATATCCGGCAGCGAAG
>probe:Drosophila_2:1623209_at:236:339; Interrogation_Position=2757; Antisense; GCTAGTTCTAGCAACGAATCCTCAT
>probe:Drosophila_2:1623209_at:484:235; Interrogation_Position=2773; Antisense; AATCCTCATCATCCGATTCTTCTGA
>probe:Drosophila_2:1623209_at:418:425; Interrogation_Position=2810; Antisense; GAGATCCAAACTCAGTAAGCCCAAG
>probe:Drosophila_2:1623209_at:719:211; Interrogation_Position=2832; Antisense; AAGAAATCGCACAAGGGCTCCAGCT
>probe:Drosophila_2:1623209_at:372:221; Interrogation_Position=2844; Antisense; AAGGGCTCCAGCTCGAAAAAGTCTA
>probe:Drosophila_2:1623209_at:263:661; Interrogation_Position=2983; Antisense; TAAATTGGCTTTCTCTCCATTTTAA

Paste this into a BLAST search page for me
GAATCTTTGCTTCCCTATTTAGTCCAAAGAACCAGCACCGACCAAGTTTGGACCAAGTTTGGTCCCATCGAGGGATGGACCAAAGTTACCGACAGCACCTAAAGCCGGCTGCTCCAGAGATTCAGGACAGACTTCAACAGCTTTGGCAGCTTTGGCAGCAGCACGCGCCTAAAAAAAGAAATGCATATCCGGCAGCGAAGGCTAGTTCTAGCAACGAATCCTCATAATCCTCATCATCCGATTCTTCTGAGAGATCCAAACTCAGTAAGCCCAAGAAGAAATCGCACAAGGGCTCCAGCTAAGGGCTCCAGCTCGAAAAAGTCTATAAATTGGCTTTCTCTCCATTTTAA

Full Affymetrix probeset data:

Annotations for 1623209_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime