FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623210_at:

>probe:Drosophila_2:1623210_at:98:523; Interrogation_Position=1010; Antisense; GGGCCAGCATTCAATCGCAGCAGCA
>probe:Drosophila_2:1623210_at:633:263; Interrogation_Position=1030; Antisense; CAGCAGCCTAGCCTTGTACTAAATG
>probe:Drosophila_2:1623210_at:174:169; Interrogation_Position=1050; Antisense; AAATGGCACTACATCGGTGGGCCTG
>probe:Drosophila_2:1623210_at:180:517; Interrogation_Position=1114; Antisense; GTGTGCAACAATGCGCCAAGCTTTG
>probe:Drosophila_2:1623210_at:30:293; Interrogation_Position=1161; Antisense; CGAGCCCTTTCGAGAGTTTCTGTAA
>probe:Drosophila_2:1623210_at:502:465; Interrogation_Position=594; Antisense; GATTGAAACACTCACACTGGCCAAA
>probe:Drosophila_2:1623210_at:534:151; Interrogation_Position=641; Antisense; ACATAATACTCTCCAAGCGCAACGA
>probe:Drosophila_2:1623210_at:598:619; Interrogation_Position=713; Antisense; TGCTCTCAAATCTTTCCTCCGAAAG
>probe:Drosophila_2:1623210_at:49:123; Interrogation_Position=750; Antisense; AGCGAGTGGTATTCCTGCAAATTCC
>probe:Drosophila_2:1623210_at:64:311; Interrogation_Position=773; Antisense; CCAATGCCGCGACGATATGCTTTGA
>probe:Drosophila_2:1623210_at:162:681; Interrogation_Position=788; Antisense; TATGCTTTGAGGATACCCTGGCCAG
>probe:Drosophila_2:1623210_at:78:435; Interrogation_Position=815; Antisense; GAGGTGCCTTTGACTGCGCCATTTT
>probe:Drosophila_2:1623210_at:2:103; Interrogation_Position=899; Antisense; AGAGCATCCAATCACAAGCCATACA
>probe:Drosophila_2:1623210_at:83:205; Interrogation_Position=914; Antisense; AAGCCATACACTTGCAGACACCGAT

Paste this into a BLAST search page for me
GGGCCAGCATTCAATCGCAGCAGCACAGCAGCCTAGCCTTGTACTAAATGAAATGGCACTACATCGGTGGGCCTGGTGTGCAACAATGCGCCAAGCTTTGCGAGCCCTTTCGAGAGTTTCTGTAAGATTGAAACACTCACACTGGCCAAAACATAATACTCTCCAAGCGCAACGATGCTCTCAAATCTTTCCTCCGAAAGAGCGAGTGGTATTCCTGCAAATTCCCCAATGCCGCGACGATATGCTTTGATATGCTTTGAGGATACCCTGGCCAGGAGGTGCCTTTGACTGCGCCATTTTAGAGCATCCAATCACAAGCCATACAAAGCCATACACTTGCAGACACCGAT

Full Affymetrix probeset data:

Annotations for 1623210_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720