FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623211_at:

>probe:Drosophila_2:1623211_at:240:367; Interrogation_Position=229; Antisense; GAAGGCAATCGGCTAGATGACCAAG
>probe:Drosophila_2:1623211_at:98:547; Interrogation_Position=271; Antisense; GGATCCGCCCTAACAGATTCCAATG
>probe:Drosophila_2:1623211_at:133:465; Interrogation_Position=286; Antisense; GATTCCAATGGAACTCTTGTCGATG
>probe:Drosophila_2:1623211_at:660:575; Interrogation_Position=311; Antisense; TGGCCGCTTTAATAATCCACGAAGA
>probe:Drosophila_2:1623211_at:596:473; Interrogation_Position=409; Antisense; GTTCAACCCATTCCTTTGGCTAAGA
>probe:Drosophila_2:1623211_at:723:45; Interrogation_Position=437; Antisense; ATCCTTATCCTAGATCGATTGCCCT
>probe:Drosophila_2:1623211_at:568:463; Interrogation_Position=496; Antisense; GATTCGACGAATTTATACCCAACAC
>probe:Drosophila_2:1623211_at:501:223; Interrogation_Position=527; Antisense; AAGGATTAGCCCTGCACATCAAAAG
>probe:Drosophila_2:1623211_at:159:183; Interrogation_Position=547; Antisense; AAAAGCATTTTCTCCTGCAGACTCT
>probe:Drosophila_2:1623211_at:389:103; Interrogation_Position=565; Antisense; AGACTCTTTGATCCTTCACTACTAT
>probe:Drosophila_2:1623211_at:256:147; Interrogation_Position=582; Antisense; ACTACTATGCGCAGGCACTTATGGA
>probe:Drosophila_2:1623211_at:143:377; Interrogation_Position=605; Antisense; GAAGAACCGCTTGTCATGGCGACTC
>probe:Drosophila_2:1623211_at:348:683; Interrogation_Position=695; Antisense; TATCCAGTGCATTCTTCGTCAGTGT
>probe:Drosophila_2:1623211_at:241:497; Interrogation_Position=712; Antisense; GTCAGTGTTCCTTATTTCCGTGAAT

Paste this into a BLAST search page for me
GAAGGCAATCGGCTAGATGACCAAGGGATCCGCCCTAACAGATTCCAATGGATTCCAATGGAACTCTTGTCGATGTGGCCGCTTTAATAATCCACGAAGAGTTCAACCCATTCCTTTGGCTAAGAATCCTTATCCTAGATCGATTGCCCTGATTCGACGAATTTATACCCAACACAAGGATTAGCCCTGCACATCAAAAGAAAAGCATTTTCTCCTGCAGACTCTAGACTCTTTGATCCTTCACTACTATACTACTATGCGCAGGCACTTATGGAGAAGAACCGCTTGTCATGGCGACTCTATCCAGTGCATTCTTCGTCAGTGTGTCAGTGTTCCTTATTTCCGTGAAT

Full Affymetrix probeset data:

Annotations for 1623211_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720