FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623214_at:

>probe:Drosophila_2:1623214_at:320:133; Interrogation_Position=103; Antisense; ACCGCCTGGTTCTTCATCTTTGTGG
>probe:Drosophila_2:1623214_at:243:473; Interrogation_Position=111; Antisense; GTTCTTCATCTTTGTGGTGTCTCGA
>probe:Drosophila_2:1623214_at:631:725; Interrogation_Position=122; Antisense; TTGTGGTGTCTCGAAAGAGCTCTAA
>probe:Drosophila_2:1623214_at:391:101; Interrogation_Position=137; Antisense; AGAGCTCTAAGGAAAGCACCTTGAT
>probe:Drosophila_2:1623214_at:707:71; Interrogation_Position=164; Antisense; AGGAACTGCTGATTAGCCTGTGCGC
>probe:Drosophila_2:1623214_at:319:605; Interrogation_Position=173; Antisense; TGATTAGCCTGTGCGCCTCCATTTT
>probe:Drosophila_2:1623214_at:11:287; Interrogation_Position=199; Antisense; CTGGGATTCGGCATTGTTTTCCTGC
>probe:Drosophila_2:1623214_at:222:657; Interrogation_Position=20; Antisense; TAATGCAGCGCTACGTATCGCCCGT
>probe:Drosophila_2:1623214_at:515:701; Interrogation_Position=215; Antisense; TTTTCCTGCTTCTAACCGTCGGTAT
>probe:Drosophila_2:1623214_at:625:199; Interrogation_Position=228; Antisense; AACCGTCGGTATTTACGTATGAGAT
>probe:Drosophila_2:1623214_at:624:427; Interrogation_Position=248; Antisense; GAGATAAGACACCATTCCGCATAGA
>probe:Drosophila_2:1623214_at:340:375; Interrogation_Position=281; Antisense; GAAGATCTGATCGTGGGCGTTAACA
>probe:Drosophila_2:1623214_at:571:311; Interrogation_Position=70; Antisense; GCCACCGTGCTTTTGGTCATCGGAA
>probe:Drosophila_2:1623214_at:653:589; Interrogation_Position=83; Antisense; TGGTCATCGGAACCTTCTTCACCGC

Paste this into a BLAST search page for me
ACCGCCTGGTTCTTCATCTTTGTGGGTTCTTCATCTTTGTGGTGTCTCGATTGTGGTGTCTCGAAAGAGCTCTAAAGAGCTCTAAGGAAAGCACCTTGATAGGAACTGCTGATTAGCCTGTGCGCTGATTAGCCTGTGCGCCTCCATTTTCTGGGATTCGGCATTGTTTTCCTGCTAATGCAGCGCTACGTATCGCCCGTTTTTCCTGCTTCTAACCGTCGGTATAACCGTCGGTATTTACGTATGAGATGAGATAAGACACCATTCCGCATAGAGAAGATCTGATCGTGGGCGTTAACAGCCACCGTGCTTTTGGTCATCGGAATGGTCATCGGAACCTTCTTCACCGC

Full Affymetrix probeset data:

Annotations for 1623214_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720