FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623217_at:

>probe:Drosophila_2:1623217_at:714:703; Interrogation_Position=3214; Antisense; TTATCTTCAGATGTAGGTGGCGCAA
>probe:Drosophila_2:1623217_at:632:79; Interrogation_Position=3228; Antisense; AGGTGGCGCAATGTTTTAATGTTTT
>probe:Drosophila_2:1623217_at:393:475; Interrogation_Position=3248; Antisense; GTTTTGACCAGGAAGACAATCGTTA
>probe:Drosophila_2:1623217_at:591:77; Interrogation_Position=3288; Antisense; AGGATACATCCAAAACAGTCAACAT
>probe:Drosophila_2:1623217_at:211:21; Interrogation_Position=3431; Antisense; ATTTGGCCGATGTTAAATTTTTGCG
>probe:Drosophila_2:1623217_at:446:713; Interrogation_Position=3451; Antisense; TTGCGGTTTTAAGCGTGAATTTCAT
>probe:Drosophila_2:1623217_at:238:229; Interrogation_Position=3478; Antisense; AATGTTTTGCAAGAATTCGCCGAAA
>probe:Drosophila_2:1623217_at:233:633; Interrogation_Position=3494; Antisense; TCGCCGAAACGAGATGAGCAAATTT
>probe:Drosophila_2:1623217_at:330:387; Interrogation_Position=3529; Antisense; GAAAACTGGTTCTCCAATTGACGTA
>probe:Drosophila_2:1623217_at:489:245; Interrogation_Position=3544; Antisense; AATTGACGTAAATTTCATCAGGCAG
>probe:Drosophila_2:1623217_at:628:35; Interrogation_Position=3560; Antisense; ATCAGGCAGATGCTGTGCGTCTTCG
>probe:Drosophila_2:1623217_at:461:507; Interrogation_Position=3574; Antisense; GTGCGTCTTCGTTGAAGCGGAAACC
>probe:Drosophila_2:1623217_at:679:329; Interrogation_Position=3590; Antisense; GCGGAAACCGTCCAAGCCAAAGACT
>probe:Drosophila_2:1623217_at:191:397; Interrogation_Position=3636; Antisense; GAAATTCGAGCCGAGTGGCACCAGC

Paste this into a BLAST search page for me
TTATCTTCAGATGTAGGTGGCGCAAAGGTGGCGCAATGTTTTAATGTTTTGTTTTGACCAGGAAGACAATCGTTAAGGATACATCCAAAACAGTCAACATATTTGGCCGATGTTAAATTTTTGCGTTGCGGTTTTAAGCGTGAATTTCATAATGTTTTGCAAGAATTCGCCGAAATCGCCGAAACGAGATGAGCAAATTTGAAAACTGGTTCTCCAATTGACGTAAATTGACGTAAATTTCATCAGGCAGATCAGGCAGATGCTGTGCGTCTTCGGTGCGTCTTCGTTGAAGCGGAAACCGCGGAAACCGTCCAAGCCAAAGACTGAAATTCGAGCCGAGTGGCACCAGC

Full Affymetrix probeset data:

Annotations for 1623217_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720