FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623224_at:

>probe:Drosophila_2:1623224_at:578:139; Interrogation_Position=116; Antisense; ACGGATTGTCGCCAGATGTGAGTCA
>probe:Drosophila_2:1623224_at:76:653; Interrogation_Position=184; Antisense; TCAATGAGAACTGTCGGCGAACACA
>probe:Drosophila_2:1623224_at:548:395; Interrogation_Position=211; Antisense; GAAATTGGCGTGAAATCTCCCGATG
>probe:Drosophila_2:1623224_at:239:395; Interrogation_Position=222; Antisense; GAAATCTCCCGATGCGAACTCGCAA
>probe:Drosophila_2:1623224_at:443:667; Interrogation_Position=23; Antisense; TACGGAATTCACGATGTCCAAGATT
>probe:Drosophila_2:1623224_at:33:249; Interrogation_Position=252; Antisense; AATTGTATATTGACCCTTGAGCGAT
>probe:Drosophila_2:1623224_at:385:123; Interrogation_Position=271; Antisense; AGCGATGTAACACGTTGTCCTGCGA
>probe:Drosophila_2:1623224_at:378:729; Interrogation_Position=285; Antisense; TTGTCCTGCGAGAATGTCCGGCGAG
>probe:Drosophila_2:1623224_at:46:289; Interrogation_Position=303; Antisense; CGGCGAGCCCTTGCACAATAAAATA
>probe:Drosophila_2:1623224_at:407:165; Interrogation_Position=367; Antisense; AAATCCGTCTTTACTGCAATTAAAT
>probe:Drosophila_2:1623224_at:339:505; Interrogation_Position=38; Antisense; GTCCAAGATTACTCTGTTTATTGCT
>probe:Drosophila_2:1623224_at:701:29; Interrogation_Position=390; Antisense; ATAAATACTTCGATGCTCTCAATAT
>probe:Drosophila_2:1623224_at:369:703; Interrogation_Position=55; Antisense; TTATTGCTTTTATTTGCCTTTTCGT
>probe:Drosophila_2:1623224_at:115:701; Interrogation_Position=73; Antisense; TTTTCGTTATCGTTCAGGCCCAAAG

Paste this into a BLAST search page for me
ACGGATTGTCGCCAGATGTGAGTCATCAATGAGAACTGTCGGCGAACACAGAAATTGGCGTGAAATCTCCCGATGGAAATCTCCCGATGCGAACTCGCAATACGGAATTCACGATGTCCAAGATTAATTGTATATTGACCCTTGAGCGATAGCGATGTAACACGTTGTCCTGCGATTGTCCTGCGAGAATGTCCGGCGAGCGGCGAGCCCTTGCACAATAAAATAAAATCCGTCTTTACTGCAATTAAATGTCCAAGATTACTCTGTTTATTGCTATAAATACTTCGATGCTCTCAATATTTATTGCTTTTATTTGCCTTTTCGTTTTTCGTTATCGTTCAGGCCCAAAG

Full Affymetrix probeset data:

Annotations for 1623224_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720