FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623226_at:

>probe:Drosophila_2:1623226_at:438:431; Interrogation_Position=440; Antisense; GAGTCGTTCCGATTGAGCAGCTTCT
>probe:Drosophila_2:1623226_at:664:339; Interrogation_Position=465; Antisense; GCTACGACAACACCTGTACCAAGTA
>probe:Drosophila_2:1623226_at:240:217; Interrogation_Position=485; Antisense; AAGTACGTGCTTTGCTATTACGGCA
>probe:Drosophila_2:1623226_at:57:509; Interrogation_Position=515; Antisense; GTGCTACGCCAATGCCACGATGGAC
>probe:Drosophila_2:1623226_at:114:441; Interrogation_Position=533; Antisense; GATGGACTCCAGTACAACAACGCCA
>probe:Drosophila_2:1623226_at:316:487; Interrogation_Position=567; Antisense; GTGACTTCCCCGAGTATGTGGACTG
>probe:Drosophila_2:1623226_at:352:99; Interrogation_Position=625; Antisense; AGAGGACATCATCTACCTGGGTAGT
>probe:Drosophila_2:1623226_at:379:481; Interrogation_Position=667; Antisense; GTATTACGTCTGTTCCAATGGTCAT
>probe:Drosophila_2:1623226_at:485:561; Interrogation_Position=697; Antisense; GGAACAGCAGTGTGCTCCTGGCTTG
>probe:Drosophila_2:1623226_at:381:507; Interrogation_Position=742; Antisense; GTGCTGCGACTTTGCCAAGAATGTT
>probe:Drosophila_2:1623226_at:166:365; Interrogation_Position=793; Antisense; GAATATTCTGCCATATTCCCGAACC
>probe:Drosophila_2:1623226_at:629:507; Interrogation_Position=828; Antisense; GTGCTGACATTAAGTGTCCCCTTAT
>probe:Drosophila_2:1623226_at:674:531; Interrogation_Position=940; Antisense; GGGTCTTTACTACGATCCCAAAGTG
>probe:Drosophila_2:1623226_at:485:319; Interrogation_Position=972; Antisense; GCCGCAGACCTGAATTCGTTGGTGT

Paste this into a BLAST search page for me
GAGTCGTTCCGATTGAGCAGCTTCTGCTACGACAACACCTGTACCAAGTAAAGTACGTGCTTTGCTATTACGGCAGTGCTACGCCAATGCCACGATGGACGATGGACTCCAGTACAACAACGCCAGTGACTTCCCCGAGTATGTGGACTGAGAGGACATCATCTACCTGGGTAGTGTATTACGTCTGTTCCAATGGTCATGGAACAGCAGTGTGCTCCTGGCTTGGTGCTGCGACTTTGCCAAGAATGTTGAATATTCTGCCATATTCCCGAACCGTGCTGACATTAAGTGTCCCCTTATGGGTCTTTACTACGATCCCAAAGTGGCCGCAGACCTGAATTCGTTGGTGT

Full Affymetrix probeset data:

Annotations for 1623226_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720