FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623229_at:

>probe:Drosophila_2:1623229_at:424:687; Interrogation_Position=1487; Antisense; TATTTGCAGGCGAAGGACCCGGAGA
>probe:Drosophila_2:1623229_at:554:551; Interrogation_Position=1507; Antisense; GGAGAGCGAGTCAAATGCCCATCAA
>probe:Drosophila_2:1623229_at:311:89; Interrogation_Position=1542; Antisense; AGTCAAGGACGGATTCAGAGGCTAA
>probe:Drosophila_2:1623229_at:337:65; Interrogation_Position=1596; Antisense; ATGGAATTCCGGGATCGCGCCTGAA
>probe:Drosophila_2:1623229_at:205:45; Interrogation_Position=1609; Antisense; ATCGCGCCTGAAGCCGCAGGGAAGT
>probe:Drosophila_2:1623229_at:225:41; Interrogation_Position=1645; Antisense; ATCTGATCTATCTGGCAAGCGCTGT
>probe:Drosophila_2:1623229_at:169:123; Interrogation_Position=1662; Antisense; AGCGCTGTCTGAATGCATATTTGGC
>probe:Drosophila_2:1623229_at:300:661; Interrogation_Position=1720; Antisense; TAAAACGTTTCGCTGCGCCCTTGTA
>probe:Drosophila_2:1623229_at:268:481; Interrogation_Position=1757; Antisense; GTTTGTACGCATTTCTTTCGCTAAC
>probe:Drosophila_2:1623229_at:318:13; Interrogation_Position=1824; Antisense; ATTCATTTTCTATTTCTGCCCGCAT
>probe:Drosophila_2:1623229_at:35:19; Interrogation_Position=1835; Antisense; ATTTCTGCCCGCATTTGCATGCGAA
>probe:Drosophila_2:1623229_at:607:207; Interrogation_Position=1937; Antisense; AAGCTCTATCTTTACTATGGCCACT
>probe:Drosophila_2:1623229_at:120:269; Interrogation_Position=2010; Antisense; CATGCGTTTATCATTCTATCCAAAT
>probe:Drosophila_2:1623229_at:153:479; Interrogation_Position=2050; Antisense; GTTTCGATCTAGTTCGATCTATTAC

Paste this into a BLAST search page for me
TATTTGCAGGCGAAGGACCCGGAGAGGAGAGCGAGTCAAATGCCCATCAAAGTCAAGGACGGATTCAGAGGCTAAATGGAATTCCGGGATCGCGCCTGAAATCGCGCCTGAAGCCGCAGGGAAGTATCTGATCTATCTGGCAAGCGCTGTAGCGCTGTCTGAATGCATATTTGGCTAAAACGTTTCGCTGCGCCCTTGTAGTTTGTACGCATTTCTTTCGCTAACATTCATTTTCTATTTCTGCCCGCATATTTCTGCCCGCATTTGCATGCGAAAAGCTCTATCTTTACTATGGCCACTCATGCGTTTATCATTCTATCCAAATGTTTCGATCTAGTTCGATCTATTAC

Full Affymetrix probeset data:

Annotations for 1623229_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720