Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623230_s_at:

>probe:Drosophila_2:1623230_s_at:199:691; Interrogation_Position=103; Antisense; TTTGGTCGAGTGAGCAACACCTTCA
>probe:Drosophila_2:1623230_s_at:572:187; Interrogation_Position=118; Antisense; AACACCTTCACTTTCGGCGATTTGT
>probe:Drosophila_2:1623230_s_at:491:725; Interrogation_Position=142; Antisense; TTGTTTCGTTGTTTGGCTGTTTTGT
>probe:Drosophila_2:1623230_s_at:586:455; Interrogation_Position=165; Antisense; GTTTAATTTCGTGTTGGTTGCTGTT
>probe:Drosophila_2:1623230_s_at:321:301; Interrogation_Position=222; Antisense; CCCGTCTCTGCTATGTCAACAAATT
>probe:Drosophila_2:1623230_s_at:656:397; Interrogation_Position=263; Antisense; GACACGGTGGACACGTTGGACACGA
>probe:Drosophila_2:1623230_s_at:221:137; Interrogation_Position=284; Antisense; ACGACGGACGAGATGGAGCCCACAA
>probe:Drosophila_2:1623230_s_at:454:587; Interrogation_Position=297; Antisense; TGGAGCCCACAAATTTGATGTCTGT
>probe:Drosophila_2:1623230_s_at:596:593; Interrogation_Position=319; Antisense; TGTGGGATATTTCCGGCTGGCCATC
>probe:Drosophila_2:1623230_s_at:408:37; Interrogation_Position=344; Antisense; ATCATCATCAGCATGGCTTTGTGGT
>probe:Drosophila_2:1623230_s_at:485:79; Interrogation_Position=398; Antisense; AGTGGAAAAATCAGAGCCCCTCGCA
>probe:Drosophila_2:1623230_s_at:205:321; Interrogation_Position=413; Antisense; GCCCCTCGCAATTCGTGTGTTATTT
>probe:Drosophila_2:1623230_s_at:66:691; Interrogation_Position=436; Antisense; TTTGTTTGGAATTTCGGCACCTGCT
>probe:Drosophila_2:1623230_s_at:540:367; Interrogation_Position=540; Antisense; GAATCGAGTCGAGGGCGTGTCTCAA

Paste this into a BLAST search page for me
TTTGGTCGAGTGAGCAACACCTTCAAACACCTTCACTTTCGGCGATTTGTTTGTTTCGTTGTTTGGCTGTTTTGTGTTTAATTTCGTGTTGGTTGCTGTTCCCGTCTCTGCTATGTCAACAAATTGACACGGTGGACACGTTGGACACGAACGACGGACGAGATGGAGCCCACAATGGAGCCCACAAATTTGATGTCTGTTGTGGGATATTTCCGGCTGGCCATCATCATCATCAGCATGGCTTTGTGGTAGTGGAAAAATCAGAGCCCCTCGCAGCCCCTCGCAATTCGTGTGTTATTTTTTGTTTGGAATTTCGGCACCTGCTGAATCGAGTCGAGGGCGTGTCTCAA

Full Affymetrix probeset data:

Annotations for 1623230_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime