FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623231_at:

>probe:Drosophila_2:1623231_at:664:491; Interrogation_Position=150; Antisense; GTAACAAAGTTAGTCGCCACACGGT
>probe:Drosophila_2:1623231_at:447:535; Interrogation_Position=172; Antisense; GGTGCTCTGTGGTTCCCAAAACATT
>probe:Drosophila_2:1623231_at:175:81; Interrogation_Position=210; Antisense; AGGTGATCGTACAGAGCGGCGCCAT
>probe:Drosophila_2:1623231_at:306:293; Interrogation_Position=244; Antisense; CGATCTGGCCAATGTCCGGACGGGA
>probe:Drosophila_2:1623231_at:151:513; Interrogation_Position=278; Antisense; GTGATTGGCAAGAACTCCGTCATCC
>probe:Drosophila_2:1623231_at:583:411; Interrogation_Position=303; Antisense; GACCGCCGTACAAACAATTCAGCAA
>probe:Drosophila_2:1623231_at:558:545; Interrogation_Position=407; Antisense; GGATCCTATGTGTACATCGGCAAGA
>probe:Drosophila_2:1623231_at:193:209; Interrogation_Position=428; Antisense; AAGAATGCCATCATAGGCCGTCGCT
>probe:Drosophila_2:1623231_at:336:677; Interrogation_Position=441; Antisense; TAGGCCGTCGCTGTGTTTTGAAAGA
>probe:Drosophila_2:1623231_at:227:107; Interrogation_Position=502; Antisense; AGAAACTACCGTGTCCAGCTACATG
>probe:Drosophila_2:1623231_at:661:263; Interrogation_Position=517; Antisense; CAGCTACATGCGTTACACGGCGAGG
>probe:Drosophila_2:1623231_at:31:523; Interrogation_Position=555; Antisense; GTGGCCAGGGCAATCCGTATTTTGT
>probe:Drosophila_2:1623231_at:462:261; Interrogation_Position=658; Antisense; CAGCTGAAAATCGTGGTGTCTACCA
>probe:Drosophila_2:1623231_at:554:533; Interrogation_Position=672; Antisense; GGTGTCTACCAATTCCATCGACAGA

Paste this into a BLAST search page for me
GTAACAAAGTTAGTCGCCACACGGTGGTGCTCTGTGGTTCCCAAAACATTAGGTGATCGTACAGAGCGGCGCCATCGATCTGGCCAATGTCCGGACGGGAGTGATTGGCAAGAACTCCGTCATCCGACCGCCGTACAAACAATTCAGCAAGGATCCTATGTGTACATCGGCAAGAAAGAATGCCATCATAGGCCGTCGCTTAGGCCGTCGCTGTGTTTTGAAAGAAGAAACTACCGTGTCCAGCTACATGCAGCTACATGCGTTACACGGCGAGGGTGGCCAGGGCAATCCGTATTTTGTCAGCTGAAAATCGTGGTGTCTACCAGGTGTCTACCAATTCCATCGACAGA

Full Affymetrix probeset data:

Annotations for 1623231_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720