Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623233_at:

>probe:Drosophila_2:1623233_at:6:393; Interrogation_Position=1788; Antisense; GAAAGACCTCCTTCCTGGTCAAATA
>probe:Drosophila_2:1623233_at:588:249; Interrogation_Position=1813; Antisense; CAATACGGGCGAGTTCCGACTGGGT
>probe:Drosophila_2:1623233_at:644:153; Interrogation_Position=1850; Antisense; ACAGTGGGCATTGCGCTTACGAACA
>probe:Drosophila_2:1623233_at:387:501; Interrogation_Position=1883; Antisense; GTCGTCGATGGAACGCGCGTCAAGC
>probe:Drosophila_2:1623233_at:283:495; Interrogation_Position=1929; Antisense; GTCAGGAGCGATTCCGGAGCGTTAC
>probe:Drosophila_2:1623233_at:679:335; Interrogation_Position=1979; Antisense; GCTCTACTGCTGCTGTACGACGTGA
>probe:Drosophila_2:1623233_at:535:407; Interrogation_Position=1997; Antisense; GACGTGACCAACAAGACCACCTATG
>probe:Drosophila_2:1623233_at:713:681; Interrogation_Position=2018; Antisense; TATGACAACATTCGCGCCTGGCTGG
>probe:Drosophila_2:1623233_at:665:527; Interrogation_Position=2157; Antisense; GGGAGCACAACGTGCCCTTCATGGA
>probe:Drosophila_2:1623233_at:268:97; Interrogation_Position=2181; Antisense; AGACCTCGGCCAAGACGGGACTCAA
>probe:Drosophila_2:1623233_at:356:555; Interrogation_Position=2198; Antisense; GGACTCAATGTGGAGCTGTCCTTCA
>probe:Drosophila_2:1623233_at:203:567; Interrogation_Position=2235; Antisense; GGCAACTAAAGAGTCGCGGCTACGA
>probe:Drosophila_2:1623233_at:84:511; Interrogation_Position=2301; Antisense; GTGACAATACAAAGGCGCGCTCGGT
>probe:Drosophila_2:1623233_at:433:639; Interrogation_Position=2321; Antisense; TCGGTTTGCGCCCAGTGCAGGAACA

Paste this into a BLAST search page for me
GAAAGACCTCCTTCCTGGTCAAATACAATACGGGCGAGTTCCGACTGGGTACAGTGGGCATTGCGCTTACGAACAGTCGTCGATGGAACGCGCGTCAAGCGTCAGGAGCGATTCCGGAGCGTTACGCTCTACTGCTGCTGTACGACGTGAGACGTGACCAACAAGACCACCTATGTATGACAACATTCGCGCCTGGCTGGGGGAGCACAACGTGCCCTTCATGGAAGACCTCGGCCAAGACGGGACTCAAGGACTCAATGTGGAGCTGTCCTTCAGGCAACTAAAGAGTCGCGGCTACGAGTGACAATACAAAGGCGCGCTCGGTTCGGTTTGCGCCCAGTGCAGGAACA

Full Affymetrix probeset data:

Annotations for 1623233_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime