Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623237_at:

>probe:Drosophila_2:1623237_at:678:545; Interrogation_Position=3288; Antisense; GGATGGCTTCACCTGCATCGAGATG
>probe:Drosophila_2:1623237_at:140:435; Interrogation_Position=3316; Antisense; GAGGGACGCAGCTGGTCCTACGAAA
>probe:Drosophila_2:1623237_at:445:279; Interrogation_Position=3333; Antisense; CTACGAAACGGATCTCTTCTGCATC
>probe:Drosophila_2:1623237_at:435:633; Interrogation_Position=3356; Antisense; TCGCGGCGACCGTTCATGTGATGCT
>probe:Drosophila_2:1623237_at:392:595; Interrogation_Position=3372; Antisense; TGTGATGCTCTTCGGTGACTATATG
>probe:Drosophila_2:1623237_at:604:173; Interrogation_Position=3435; Antisense; AAAGCTGCCGCGTTACCTCAAAAAG
>probe:Drosophila_2:1623237_at:622:115; Interrogation_Position=3458; Antisense; AGCATGTGTGGACCAAGTTCTTCGG
>probe:Drosophila_2:1623237_at:531:51; Interrogation_Position=3529; Antisense; ATGCGTCTCATCTTCGAGGAGGAGG
>probe:Drosophila_2:1623237_at:426:67; Interrogation_Position=3562; Antisense; ATGGACTCCGAGCTGCAGAAGCAGA
>probe:Drosophila_2:1623237_at:61:683; Interrogation_Position=3596; Antisense; TATCCAACATCCTGCATCGACGATA
>probe:Drosophila_2:1623237_at:578:657; Interrogation_Position=3619; Antisense; TAACCAATCTATTCCTATTCCTTTC
>probe:Drosophila_2:1623237_at:690:659; Interrogation_Position=3663; Antisense; TAACTCTGTTGACCAAGTCACCCAT
>probe:Drosophila_2:1623237_at:193:179; Interrogation_Position=3713; Antisense; AAACAATTTTCCCTCTTCAAAGATG
>probe:Drosophila_2:1623237_at:431:697; Interrogation_Position=3784; Antisense; TTTCTGCGAACAAACTCCCTTTTAT

Paste this into a BLAST search page for me
GGATGGCTTCACCTGCATCGAGATGGAGGGACGCAGCTGGTCCTACGAAACTACGAAACGGATCTCTTCTGCATCTCGCGGCGACCGTTCATGTGATGCTTGTGATGCTCTTCGGTGACTATATGAAAGCTGCCGCGTTACCTCAAAAAGAGCATGTGTGGACCAAGTTCTTCGGATGCGTCTCATCTTCGAGGAGGAGGATGGACTCCGAGCTGCAGAAGCAGATATCCAACATCCTGCATCGACGATATAACCAATCTATTCCTATTCCTTTCTAACTCTGTTGACCAAGTCACCCATAAACAATTTTCCCTCTTCAAAGATGTTTCTGCGAACAAACTCCCTTTTAT

Full Affymetrix probeset data:

Annotations for 1623237_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime