FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623238_at:

>probe:Drosophila_2:1623238_at:165:187; Interrogation_Position=1361; Antisense; AACAAGAGTGTCCAGTGCGGCCGCA
>probe:Drosophila_2:1623238_at:333:451; Interrogation_Position=1387; Antisense; GATCGACGCTTTCAAGTTCTGGCTA
>probe:Drosophila_2:1623238_at:54:641; Interrogation_Position=1404; Antisense; TCTGGCTAATGCTTAAGGCTCGCGG
>probe:Drosophila_2:1623238_at:464:681; Interrogation_Position=1439; Antisense; TATGGACTCATGGTGGACCACGCCA
>probe:Drosophila_2:1623238_at:615:47; Interrogation_Position=1463; Antisense; ATCCACATCGCCAGGTTGCTGGAAG
>probe:Drosophila_2:1623238_at:627:43; Interrogation_Position=1509; Antisense; ATCGCTTTAGACTGGTGATCCCGGA
>probe:Drosophila_2:1623238_at:151:355; Interrogation_Position=1534; Antisense; GCACGAGTACTCCAATGTCTGCTTT
>probe:Drosophila_2:1623238_at:438:599; Interrogation_Position=1549; Antisense; TGTCTGCTTTTGGTTCATTCCGAAA
>probe:Drosophila_2:1623238_at:674:133; Interrogation_Position=1601; Antisense; ACGCCTGAATGGTGGAGTCGACTTT
>probe:Drosophila_2:1623238_at:33:401; Interrogation_Position=1620; Antisense; GACTTTACACTGTGGCCCCGAAAAT
>probe:Drosophila_2:1623238_at:30:323; Interrogation_Position=1658; Antisense; GCCCACAGCGGCACTTTGATGATTG
>probe:Drosophila_2:1623238_at:647:605; Interrogation_Position=1674; Antisense; TGATGATTGGTTACTCGCCTCTTAA
>probe:Drosophila_2:1623238_at:728:183; Interrogation_Position=1704; Antisense; AAAATCTGGGCAACTTCTTTCGCAT
>probe:Drosophila_2:1623238_at:149:713; Interrogation_Position=1733; Antisense; TTCACTTGTTTTCCCATCCTGAAAA

Paste this into a BLAST search page for me
AACAAGAGTGTCCAGTGCGGCCGCAGATCGACGCTTTCAAGTTCTGGCTATCTGGCTAATGCTTAAGGCTCGCGGTATGGACTCATGGTGGACCACGCCAATCCACATCGCCAGGTTGCTGGAAGATCGCTTTAGACTGGTGATCCCGGAGCACGAGTACTCCAATGTCTGCTTTTGTCTGCTTTTGGTTCATTCCGAAAACGCCTGAATGGTGGAGTCGACTTTGACTTTACACTGTGGCCCCGAAAATGCCCACAGCGGCACTTTGATGATTGTGATGATTGGTTACTCGCCTCTTAAAAAATCTGGGCAACTTCTTTCGCATTTCACTTGTTTTCCCATCCTGAAAA

Full Affymetrix probeset data:

Annotations for 1623238_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720