FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623239_at:

>probe:Drosophila_2:1623239_at:62:415; Interrogation_Position=1029; Antisense; GAGCGGGAACCCAGTTCGCTGACAA
>probe:Drosophila_2:1623239_at:58:115; Interrogation_Position=1078; Antisense; AGCAGATCGCGCACCAGCTGAAGCG
>probe:Drosophila_2:1623239_at:14:121; Interrogation_Position=1093; Antisense; AGCTGAAGCGACTGGCCGACATCAA
>probe:Drosophila_2:1623239_at:552:401; Interrogation_Position=1110; Antisense; GACATCAAATTCGAGACACTGCAAT
>probe:Drosophila_2:1623239_at:596:487; Interrogation_Position=1175; Antisense; GTACGATCCGCCGTCCTTATAGTGT
>probe:Drosophila_2:1623239_at:458:687; Interrogation_Position=1192; Antisense; TATAGTGTCCCAAGCGGCAGGGCGA
>probe:Drosophila_2:1623239_at:24:37; Interrogation_Position=1218; Antisense; ATCAGTGGGTCTAAGCAGTCGGCAA
>probe:Drosophila_2:1623239_at:257:567; Interrogation_Position=1238; Antisense; GGCAAAAACTCCAGCACCAGCAGAA
>probe:Drosophila_2:1623239_at:26:381; Interrogation_Position=1260; Antisense; GAAGCCACGGCGAAAGGATCAGCAT
>probe:Drosophila_2:1623239_at:471:495; Interrogation_Position=1310; Antisense; GTCAGCTCGAATTGTATAGGTCTTT
>probe:Drosophila_2:1623239_at:316:25; Interrogation_Position=1325; Antisense; ATAGGTCTTTTACGAATGTGCTCTT
>probe:Drosophila_2:1623239_at:8:231; Interrogation_Position=1339; Antisense; AATGTGCTCTTTGGCACTCGAACGT
>probe:Drosophila_2:1623239_at:51:629; Interrogation_Position=1356; Antisense; TCGAACGTTTTCTAGCTCTCCAAGT
>probe:Drosophila_2:1623239_at:493:209; Interrogation_Position=1495; Antisense; AAGCACTTCATCTACGATATCCATA

Paste this into a BLAST search page for me
GAGCGGGAACCCAGTTCGCTGACAAAGCAGATCGCGCACCAGCTGAAGCGAGCTGAAGCGACTGGCCGACATCAAGACATCAAATTCGAGACACTGCAATGTACGATCCGCCGTCCTTATAGTGTTATAGTGTCCCAAGCGGCAGGGCGAATCAGTGGGTCTAAGCAGTCGGCAAGGCAAAAACTCCAGCACCAGCAGAAGAAGCCACGGCGAAAGGATCAGCATGTCAGCTCGAATTGTATAGGTCTTTATAGGTCTTTTACGAATGTGCTCTTAATGTGCTCTTTGGCACTCGAACGTTCGAACGTTTTCTAGCTCTCCAAGTAAGCACTTCATCTACGATATCCATA

Full Affymetrix probeset data:

Annotations for 1623239_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720