Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623242_at:

>probe:Drosophila_2:1623242_at:263:191; Interrogation_Position=1097; Antisense; AACTACAATCCCGAAGAGCCCAAGA
>probe:Drosophila_2:1623242_at:377:321; Interrogation_Position=1114; Antisense; GCCCAAGATCCACAACAAAGCAAAT
>probe:Drosophila_2:1623242_at:623:341; Interrogation_Position=1139; Antisense; GCTTTCATCTTTTTGAGCAATGCTG
>probe:Drosophila_2:1623242_at:88:395; Interrogation_Position=1175; Antisense; GAAATAGTTTTTCCTTCTCGCCATT
>probe:Drosophila_2:1623242_at:168:719; Interrogation_Position=1185; Antisense; TTCCTTCTCGCCATTTAAAAGTCAG
>probe:Drosophila_2:1623242_at:458:213; Interrogation_Position=1203; Antisense; AAGTCAGACCTCGAAAGGGTTCAAT
>probe:Drosophila_2:1623242_at:222:89; Interrogation_Position=1253; Antisense; AGTCTTATTTATCATCAGTGTCCAA
>probe:Drosophila_2:1623242_at:109:663; Interrogation_Position=1314; Antisense; TAAACTGACGTTTGTACTTCATAAT
>probe:Drosophila_2:1623242_at:639:651; Interrogation_Position=1335; Antisense; TAATTTATGTACTCTTGGAAGGCGA
>probe:Drosophila_2:1623242_at:639:225; Interrogation_Position=1353; Antisense; AAGGCGATTTTCCATTTATTTCAAG
>probe:Drosophila_2:1623242_at:718:473; Interrogation_Position=1377; Antisense; GTTAAGCACTTGACACTTTCTGAGT
>probe:Drosophila_2:1623242_at:160:713; Interrogation_Position=1394; Antisense; TTCTGAGTTATTGCGAAAGTCTGCT
>probe:Drosophila_2:1623242_at:576:271; Interrogation_Position=944; Antisense; CATTTATCAGGGAATTGCAGTTGCA
>probe:Drosophila_2:1623242_at:228:559; Interrogation_Position=974; Antisense; GGAAATCTTTCTACTTCTTTACATG

Paste this into a BLAST search page for me
AACTACAATCCCGAAGAGCCCAAGAGCCCAAGATCCACAACAAAGCAAATGCTTTCATCTTTTTGAGCAATGCTGGAAATAGTTTTTCCTTCTCGCCATTTTCCTTCTCGCCATTTAAAAGTCAGAAGTCAGACCTCGAAAGGGTTCAATAGTCTTATTTATCATCAGTGTCCAATAAACTGACGTTTGTACTTCATAATTAATTTATGTACTCTTGGAAGGCGAAAGGCGATTTTCCATTTATTTCAAGGTTAAGCACTTGACACTTTCTGAGTTTCTGAGTTATTGCGAAAGTCTGCTCATTTATCAGGGAATTGCAGTTGCAGGAAATCTTTCTACTTCTTTACATG

Full Affymetrix probeset data:

Annotations for 1623242_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime