FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623246_at:

>probe:Drosophila_2:1623246_at:455:435; Interrogation_Position=1042; Antisense; GAGGATGATCAGCTGCCCAATCTTC
>probe:Drosophila_2:1623246_at:727:387; Interrogation_Position=1084; Antisense; GAAAAGTGGTTACCCCAGGCTGACA
>probe:Drosophila_2:1623246_at:551:573; Interrogation_Position=1101; Antisense; GGCTGACATATTGGCACATCCGAAT
>probe:Drosophila_2:1623246_at:252:713; Interrogation_Position=1135; Antisense; TTCATCGCCCATGGAGGACTGTTTG
>probe:Drosophila_2:1623246_at:653:75; Interrogation_Position=1166; Antisense; AGGAGGCAGTTTACCATGCGGTCCC
>probe:Drosophila_2:1623246_at:18:565; Interrogation_Position=1198; Antisense; GGAATGCCATTCTATTTCGATCAGG
>probe:Drosophila_2:1623246_at:15:51; Interrogation_Position=1256; Antisense; ATGCCATTGGCTTGGACTATCGCAC
>probe:Drosophila_2:1623246_at:480:453; Interrogation_Position=1291; Antisense; GATCAACTTAAGTCTGCGCTTCATG
>probe:Drosophila_2:1623246_at:306:323; Interrogation_Position=1306; Antisense; GCGCTTCATGCGCTCTTGAAAGATC
>probe:Drosophila_2:1623246_at:80:173; Interrogation_Position=1354; Antisense; AAAGCATCGCGAATTTTCCGGGATC
>probe:Drosophila_2:1623246_at:50:577; Interrogation_Position=1387; Antisense; GGCGCAATGGACACCGCGATGTATT
>probe:Drosophila_2:1623246_at:247:77; Interrogation_Position=1461; Antisense; AGGAGTGCATCTGCCCTGGTACCAG
>probe:Drosophila_2:1623246_at:146:571; Interrogation_Position=1518; Antisense; GGCTATTACTCTATTACCACTTTTG
>probe:Drosophila_2:1623246_at:677:127; Interrogation_Position=1533; Antisense; ACCACTTTTGACCTTGTATGCTGTA

Paste this into a BLAST search page for me
GAGGATGATCAGCTGCCCAATCTTCGAAAAGTGGTTACCCCAGGCTGACAGGCTGACATATTGGCACATCCGAATTTCATCGCCCATGGAGGACTGTTTGAGGAGGCAGTTTACCATGCGGTCCCGGAATGCCATTCTATTTCGATCAGGATGCCATTGGCTTGGACTATCGCACGATCAACTTAAGTCTGCGCTTCATGGCGCTTCATGCGCTCTTGAAAGATCAAAGCATCGCGAATTTTCCGGGATCGGCGCAATGGACACCGCGATGTATTAGGAGTGCATCTGCCCTGGTACCAGGGCTATTACTCTATTACCACTTTTGACCACTTTTGACCTTGTATGCTGTA

Full Affymetrix probeset data:

Annotations for 1623246_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720