Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623247_at:

>probe:Drosophila_2:1623247_at:200:425; Interrogation_Position=1244; Antisense; GAGACCACCGAAGATATGTGCACCA
>probe:Drosophila_2:1623247_at:365:53; Interrogation_Position=1268; Antisense; AGCACGTGGTCGCAAAGTTCCGGTC
>probe:Drosophila_2:1623247_at:574:171; Interrogation_Position=1281; Antisense; AAAGTTCCGGTCTCAGGCATGCACT
>probe:Drosophila_2:1623247_at:590:569; Interrogation_Position=1296; Antisense; GGCATGCACTATTAACCGTTCGCAA
>probe:Drosophila_2:1623247_at:567:41; Interrogation_Position=1320; Antisense; ATCGGTATGCCAACAGCACGGACGA
>probe:Drosophila_2:1623247_at:270:133; Interrogation_Position=1341; Antisense; ACGAGTACCGACTGGAGGTGTCCCA
>probe:Drosophila_2:1623247_at:299:549; Interrogation_Position=1354; Antisense; GGAGGTGTCCCAGATTTTGGCCAAA
>probe:Drosophila_2:1623247_at:446:461; Interrogation_Position=1366; Antisense; GATTTTGGCCAAACTGTGCGAGAGA
>probe:Drosophila_2:1623247_at:566:465; Interrogation_Position=1389; Antisense; GATTGTTCAACAAGCCCAAGCACAC
>probe:Drosophila_2:1623247_at:702:153; Interrogation_Position=1410; Antisense; ACACCGAACTGTAATCCTAGCCAAT
>probe:Drosophila_2:1623247_at:575:619; Interrogation_Position=1550; Antisense; TGCTCTTTGTCATTAACTTAGGATA
>probe:Drosophila_2:1623247_at:234:239; Interrogation_Position=1661; Antisense; AATAGGCAGACGATTCACCAACGAG
>probe:Drosophila_2:1623247_at:478:603; Interrogation_Position=1702; Antisense; TGTTGTTACACGTCATTAAACTAGC
>probe:Drosophila_2:1623247_at:262:485; Interrogation_Position=1735; Antisense; GTATGCTACAGAATTGTTCTCCAAA

Paste this into a BLAST search page for me
GAGACCACCGAAGATATGTGCACCAAGCACGTGGTCGCAAAGTTCCGGTCAAAGTTCCGGTCTCAGGCATGCACTGGCATGCACTATTAACCGTTCGCAAATCGGTATGCCAACAGCACGGACGAACGAGTACCGACTGGAGGTGTCCCAGGAGGTGTCCCAGATTTTGGCCAAAGATTTTGGCCAAACTGTGCGAGAGAGATTGTTCAACAAGCCCAAGCACACACACCGAACTGTAATCCTAGCCAATTGCTCTTTGTCATTAACTTAGGATAAATAGGCAGACGATTCACCAACGAGTGTTGTTACACGTCATTAAACTAGCGTATGCTACAGAATTGTTCTCCAAA

Full Affymetrix probeset data:

Annotations for 1623247_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime