FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623250_at:

>probe:Drosophila_2:1623250_at:349:65; Interrogation_Position=131; Antisense; ATGGTGCAGCCCATCAACCTGATCT
>probe:Drosophila_2:1623250_at:152:605; Interrogation_Position=150; Antisense; TGATCTTCCGTTACCTGCAGAACCG
>probe:Drosophila_2:1623250_at:177:503; Interrogation_Position=175; Antisense; GTCCCGCGTGCAAGTTTGGTTATAC
>probe:Drosophila_2:1623250_at:570:385; Interrogation_Position=202; Antisense; GAACATATCGCTGCGCATCGAGGGC
>probe:Drosophila_2:1623250_at:148:313; Interrogation_Position=225; Antisense; GCCACATTGTGGGATTCGATGAGTA
>probe:Drosophila_2:1623250_at:361:89; Interrogation_Position=280; Antisense; AGTCTATGTGAAGACCCGGCAGCGC
>probe:Drosophila_2:1623250_at:431:123; Interrogation_Position=300; Antisense; AGCGCCGCAACCTCGGGAGGATCAT
>probe:Drosophila_2:1623250_at:605:543; Interrogation_Position=318; Antisense; GGATCATGCTCAAGGGCGACAACAT
>probe:Drosophila_2:1623250_at:27:399; Interrogation_Position=335; Antisense; GACAACATCACGCTCATACAGAACG
>probe:Drosophila_2:1623250_at:389:29; Interrogation_Position=350; Antisense; ATACAGAACGTCAGTCCCACGAAGG
>probe:Drosophila_2:1623250_at:696:367; Interrogation_Position=370; Antisense; GAAGGACTAGGCGACTCAGCGGCCA
>probe:Drosophila_2:1623250_at:416:367; Interrogation_Position=401; Antisense; GAATCCTTCGAATTCCACCTGCAAA
>probe:Drosophila_2:1623250_at:235:615; Interrogation_Position=420; Antisense; TGCAAACGCTGAACGCCCTTAATAT
>probe:Drosophila_2:1623250_at:707:227; Interrogation_Position=94; Antisense; AATGTCGTTCAAAGGAAATCCCAAG

Paste this into a BLAST search page for me
ATGGTGCAGCCCATCAACCTGATCTTGATCTTCCGTTACCTGCAGAACCGGTCCCGCGTGCAAGTTTGGTTATACGAACATATCGCTGCGCATCGAGGGCGCCACATTGTGGGATTCGATGAGTAAGTCTATGTGAAGACCCGGCAGCGCAGCGCCGCAACCTCGGGAGGATCATGGATCATGCTCAAGGGCGACAACATGACAACATCACGCTCATACAGAACGATACAGAACGTCAGTCCCACGAAGGGAAGGACTAGGCGACTCAGCGGCCAGAATCCTTCGAATTCCACCTGCAAATGCAAACGCTGAACGCCCTTAATATAATGTCGTTCAAAGGAAATCCCAAG

Full Affymetrix probeset data:

Annotations for 1623250_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720