FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623251_at:

>probe:Drosophila_2:1623251_at:458:159; Interrogation_Position=1004; Antisense; ACAAACAGATCGACTTTCCCGCTGA
>probe:Drosophila_2:1623251_at:178:673; Interrogation_Position=1031; Antisense; TACGCCTCGAATTCTCACAACAAGA
>probe:Drosophila_2:1623251_at:255:709; Interrogation_Position=1106; Antisense; TTACTCGTCTCGTGCTTCAGCAAGA
>probe:Drosophila_2:1623251_at:402:347; Interrogation_Position=1144; Antisense; GCATCTGTATCTCGCAACTCTAAAA
>probe:Drosophila_2:1623251_at:415:485; Interrogation_Position=1162; Antisense; TCTAAAAACTCCTCTCCAAGTCGAG
>probe:Drosophila_2:1623251_at:642:23; Interrogation_Position=1213; Antisense; ATATGAACTCGACTCTTTTTGGCCT
>probe:Drosophila_2:1623251_at:676:275; Interrogation_Position=1227; Antisense; CTTTTTGGCCTTTGCACTTTGTATT
>probe:Drosophila_2:1623251_at:188:567; Interrogation_Position=1319; Antisense; GGCACAACTGCATTTCCATGGAATA
>probe:Drosophila_2:1623251_at:344:95; Interrogation_Position=1354; Antisense; AGATTATTTTGAGCTTGGCCCCACT
>probe:Drosophila_2:1623251_at:334:273; Interrogation_Position=1367; Antisense; CTTGGCCCCACTTAGCTAATTAGAA
>probe:Drosophila_2:1623251_at:616:695; Interrogation_Position=1418; Antisense; TTTCTTTCATTACTGCCCACATATT
>probe:Drosophila_2:1623251_at:186:665; Interrogation_Position=1481; Antisense; TAAATACTTGATGCTGGCCCTGTCC
>probe:Drosophila_2:1623251_at:416:445; Interrogation_Position=942; Antisense; GATGCGAACCCATTACAACGTGGAA
>probe:Drosophila_2:1623251_at:128:197; Interrogation_Position=958; Antisense; AACGTGGAACATCAGATCCCCGAAA

Paste this into a BLAST search page for me
ACAAACAGATCGACTTTCCCGCTGATACGCCTCGAATTCTCACAACAAGATTACTCGTCTCGTGCTTCAGCAAGAGCATCTGTATCTCGCAACTCTAAAATCTAAAAACTCCTCTCCAAGTCGAGATATGAACTCGACTCTTTTTGGCCTCTTTTTGGCCTTTGCACTTTGTATTGGCACAACTGCATTTCCATGGAATAAGATTATTTTGAGCTTGGCCCCACTCTTGGCCCCACTTAGCTAATTAGAATTTCTTTCATTACTGCCCACATATTTAAATACTTGATGCTGGCCCTGTCCGATGCGAACCCATTACAACGTGGAAAACGTGGAACATCAGATCCCCGAAA

Full Affymetrix probeset data:

Annotations for 1623251_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720