FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623256_at:

>probe:Drosophila_2:1623256_at:360:311; Interrogation_Position=299; Antisense; CCAAGTCGGATGAGCTGTATCCCAA
>probe:Drosophila_2:1623256_at:506:41; Interrogation_Position=326; Antisense; ATCTGGCCAAGCGTGCGATCGTCAA
>probe:Drosophila_2:1623256_at:670:291; Interrogation_Position=341; Antisense; CGATCGTCAATCAGCGTCTCTTCTT
>probe:Drosophila_2:1623256_at:396:499; Interrogation_Position=356; Antisense; GTCTCTTCTTCGATGCCAGTGTAAT
>probe:Drosophila_2:1623256_at:468:49; Interrogation_Position=368; Antisense; ATGCCAGTGTAATCTATGCCAGTAT
>probe:Drosophila_2:1623256_at:303:627; Interrogation_Position=384; Antisense; TGCCAGTATAGCCAATGTCAGCCGC
>probe:Drosophila_2:1623256_at:601:597; Interrogation_Position=399; Antisense; TGTCAGCCGCCCGTTTTGGATAAAC
>probe:Drosophila_2:1623256_at:385:583; Interrogation_Position=452; Antisense; TGGACGCCGTACACCAGGGTCTGAA
>probe:Drosophila_2:1623256_at:480:585; Interrogation_Position=482; Antisense; TGGAGACGTTCCTGGGCAACAGCCC
>probe:Drosophila_2:1623256_at:498:335; Interrogation_Position=574; Antisense; GCTGCCGTGGACATAGATCCTGCTA
>probe:Drosophila_2:1623256_at:115:97; Interrogation_Position=588; Antisense; AGATCCTGCTACATATCCCAAGGTC
>probe:Drosophila_2:1623256_at:550:541; Interrogation_Position=620; Antisense; GGTTGGATCGCCTCAATAAGCTGCC
>probe:Drosophila_2:1623256_at:503:427; Interrogation_Position=655; Antisense; GAGATCAACGAAGCTCCGGCCCAGA
>probe:Drosophila_2:1623256_at:520:361; Interrogation_Position=701; Antisense; GCAAGTGGACCAAGCTGGGCGACAA

Paste this into a BLAST search page for me
CCAAGTCGGATGAGCTGTATCCCAAATCTGGCCAAGCGTGCGATCGTCAACGATCGTCAATCAGCGTCTCTTCTTGTCTCTTCTTCGATGCCAGTGTAATATGCCAGTGTAATCTATGCCAGTATTGCCAGTATAGCCAATGTCAGCCGCTGTCAGCCGCCCGTTTTGGATAAACTGGACGCCGTACACCAGGGTCTGAATGGAGACGTTCCTGGGCAACAGCCCGCTGCCGTGGACATAGATCCTGCTAAGATCCTGCTACATATCCCAAGGTCGGTTGGATCGCCTCAATAAGCTGCCGAGATCAACGAAGCTCCGGCCCAGAGCAAGTGGACCAAGCTGGGCGACAA

Full Affymetrix probeset data:

Annotations for 1623256_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720