FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623258_at:

>probe:Drosophila_2:1623258_at:689:301; Interrogation_Position=1045; Antisense; CCTTAAAACATATTCCCGGCATTCA
>probe:Drosophila_2:1623258_at:371:571; Interrogation_Position=567; Antisense; GGCTCTGCGAGAAATCCTAACCACC
>probe:Drosophila_2:1623258_at:272:99; Interrogation_Position=659; Antisense; AGATGACCTCTTATGCCGTTTACAA
>probe:Drosophila_2:1623258_at:90:327; Interrogation_Position=704; Antisense; GCGACGCTATTGATGTTGCAGCCCT
>probe:Drosophila_2:1623258_at:320:469; Interrogation_Position=718; Antisense; GTTGCAGCCCTGTATAATGACGTAA
>probe:Drosophila_2:1623258_at:285:105; Interrogation_Position=752; Antisense; AGACGTCGTCGTCAGTTGGACAGTT
>probe:Drosophila_2:1623258_at:373:269; Interrogation_Position=807; Antisense; CATGGTTCTGATGCAAATGCGCCCC
>probe:Drosophila_2:1623258_at:666:255; Interrogation_Position=843; Antisense; CAAATTTTTAGGTAGCTCTGGTGAA
>probe:Drosophila_2:1623258_at:447:171; Interrogation_Position=874; Antisense; AAAGTTTTCTCAATGGGCGTCTCCG
>probe:Drosophila_2:1623258_at:571:593; Interrogation_Position=887; Antisense; TGGGCGTCTCCGTGGACAACTGCGA
>probe:Drosophila_2:1623258_at:484:91; Interrogation_Position=911; Antisense; AGTTTAAGGCTGATGGGCCAACCAA
>probe:Drosophila_2:1623258_at:232:99; Interrogation_Position=939; Antisense; AGATGCACGCCGCAAAGTAGCCGCA
>probe:Drosophila_2:1623258_at:375:217; Interrogation_Position=953; Antisense; AAGTAGCCGCATTAGTTTGTAACAA
>probe:Drosophila_2:1623258_at:716:131; Interrogation_Position=988; Antisense; ACCGACTATCCACAAGCATAAGCGA

Paste this into a BLAST search page for me
CCTTAAAACATATTCCCGGCATTCAGGCTCTGCGAGAAATCCTAACCACCAGATGACCTCTTATGCCGTTTACAAGCGACGCTATTGATGTTGCAGCCCTGTTGCAGCCCTGTATAATGACGTAAAGACGTCGTCGTCAGTTGGACAGTTCATGGTTCTGATGCAAATGCGCCCCCAAATTTTTAGGTAGCTCTGGTGAAAAAGTTTTCTCAATGGGCGTCTCCGTGGGCGTCTCCGTGGACAACTGCGAAGTTTAAGGCTGATGGGCCAACCAAAGATGCACGCCGCAAAGTAGCCGCAAAGTAGCCGCATTAGTTTGTAACAAACCGACTATCCACAAGCATAAGCGA

Full Affymetrix probeset data:

Annotations for 1623258_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720