FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623259_at:

>probe:Drosophila_2:1623259_at:146:709; Interrogation_Position=101; Antisense; TTAACTGGGCATTAAATCGGGCCAA
>probe:Drosophila_2:1623259_at:411:613; Interrogation_Position=128; Antisense; TGAAACAATCGACGGCAGCCAATTC
>probe:Drosophila_2:1623259_at:30:691; Interrogation_Position=168; Antisense; TTTGCTGTCGTCGTTGCTGCTCCTA
>probe:Drosophila_2:1623259_at:12:451; Interrogation_Position=18; Antisense; GATCGGGCTTAGTGAGTTCCATAAT
>probe:Drosophila_2:1623259_at:322:335; Interrogation_Position=183; Antisense; GCTGCTCCTAAATTTGCTACACTTA
>probe:Drosophila_2:1623259_at:467:649; Interrogation_Position=206; Antisense; TAATTGGAGCCGACGAGGCGTTTTC
>probe:Drosophila_2:1623259_at:31:1; Interrogation_Position=221; Antisense; AGGCGTTTTCGTGTCCCAATGGTTG
>probe:Drosophila_2:1623259_at:5:311; Interrogation_Position=236; Antisense; CCAATGGTTGGGAACTGCGCGGCTT
>probe:Drosophila_2:1623259_at:519:283; Interrogation_Position=250; Antisense; CTGCGCGGCTTGAATTGTTATAAAT
>probe:Drosophila_2:1623259_at:110:19; Interrogation_Position=275; Antisense; ATTTCAATATCAAGCACTCGTGGGA
>probe:Drosophila_2:1623259_at:568:453; Interrogation_Position=298; Antisense; GATAAAAGCGCCGAACTGTGTCGAA
>probe:Drosophila_2:1623259_at:469:595; Interrogation_Position=314; Antisense; TGTGTCGAAGATACGGCGCCGAACT
>probe:Drosophila_2:1623259_at:50:589; Interrogation_Position=57; Antisense; TGGAGAGCTTCAGCCCAATGAGAAT
>probe:Drosophila_2:1623259_at:425:391; Interrogation_Position=88; Antisense; GAAACCAACGCGCTTAACTGGGCAT

Paste this into a BLAST search page for me
TTAACTGGGCATTAAATCGGGCCAATGAAACAATCGACGGCAGCCAATTCTTTGCTGTCGTCGTTGCTGCTCCTAGATCGGGCTTAGTGAGTTCCATAATGCTGCTCCTAAATTTGCTACACTTATAATTGGAGCCGACGAGGCGTTTTCAGGCGTTTTCGTGTCCCAATGGTTGCCAATGGTTGGGAACTGCGCGGCTTCTGCGCGGCTTGAATTGTTATAAATATTTCAATATCAAGCACTCGTGGGAGATAAAAGCGCCGAACTGTGTCGAATGTGTCGAAGATACGGCGCCGAACTTGGAGAGCTTCAGCCCAATGAGAATGAAACCAACGCGCTTAACTGGGCAT

Full Affymetrix probeset data:

Annotations for 1623259_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720