FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623261_at:

>probe:Drosophila_2:1623261_at:192:181; Interrogation_Position=447; Antisense; AAAACTTCGATATGCCCTTCTTTGA
>probe:Drosophila_2:1623261_at:349:241; Interrogation_Position=494; Antisense; AATATCGAAGATGCCTTCCTGTCCC
>probe:Drosophila_2:1623261_at:82:581; Interrogation_Position=519; Antisense; TGGCCCGTAAAATCCGCGAGCAAAG
>probe:Drosophila_2:1623261_at:615:171; Interrogation_Position=581; Antisense; AAAGACAAGAAATCACCCGGCTCCA
>probe:Drosophila_2:1623261_at:386:227; Interrogation_Position=605; Antisense; AATGGCCTAGGAACCTTCAGTCTGG
>probe:Drosophila_2:1623261_at:18:423; Interrogation_Position=644; Antisense; GAGAATCGCTGCACCTGCTAAATAC
>probe:Drosophila_2:1623261_at:628:439; Interrogation_Position=674; Antisense; GATGGATTACGATGCGACCGCAACC
>probe:Drosophila_2:1623261_at:549:351; Interrogation_Position=706; Antisense; GCAGAACCTGAGCAAGTTGTCCAAA
>probe:Drosophila_2:1623261_at:595:5; Interrogation_Position=734; Antisense; ATTGAGCGTTGTAGCATTGTGGCCA
>probe:Drosophila_2:1623261_at:295:5; Interrogation_Position=749; Antisense; ATTGTGGCCAACTTCGCGAACGGGC
>probe:Drosophila_2:1623261_at:717:379; Interrogation_Position=766; Antisense; GAACGGGCCACCTTTTAGATGCAAA
>probe:Drosophila_2:1623261_at:360:93; Interrogation_Position=793; Antisense; AGTTAAGGGACTGGGCTGCCTGCAT
>probe:Drosophila_2:1623261_at:369:627; Interrogation_Position=809; Antisense; TGCCTGCATTGCATTCCTGATGGAA
>probe:Drosophila_2:1623261_at:149:667; Interrogation_Position=922; Antisense; TACATGCATATTGTCTCGATTCCAA

Paste this into a BLAST search page for me
AAAACTTCGATATGCCCTTCTTTGAAATATCGAAGATGCCTTCCTGTCCCTGGCCCGTAAAATCCGCGAGCAAAGAAAGACAAGAAATCACCCGGCTCCAAATGGCCTAGGAACCTTCAGTCTGGGAGAATCGCTGCACCTGCTAAATACGATGGATTACGATGCGACCGCAACCGCAGAACCTGAGCAAGTTGTCCAAAATTGAGCGTTGTAGCATTGTGGCCAATTGTGGCCAACTTCGCGAACGGGCGAACGGGCCACCTTTTAGATGCAAAAGTTAAGGGACTGGGCTGCCTGCATTGCCTGCATTGCATTCCTGATGGAATACATGCATATTGTCTCGATTCCAA

Full Affymetrix probeset data:

Annotations for 1623261_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720