Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623264_at:

>probe:Drosophila_2:1623264_at:186:495; Interrogation_Position=4479; Antisense; GTCAAGGTGATATCGGCAGTGCTCA
>probe:Drosophila_2:1623264_at:377:267; Interrogation_Position=4495; Antisense; CAGTGCTCAAATTTTCGCCGCAGCA
>probe:Drosophila_2:1623264_at:209:185; Interrogation_Position=4537; Antisense; AAAAGGAGCATCAGCGGCGATCGCT
>probe:Drosophila_2:1623264_at:455:115; Interrogation_Position=4579; Antisense; AGCATGAACTGATGGCTCTCTACGG
>probe:Drosophila_2:1623264_at:161:427; Interrogation_Position=4606; Antisense; GAGATTGGAACTGGGAGCCCTGCCC
>probe:Drosophila_2:1623264_at:177:533; Interrogation_Position=4631; Antisense; GGTGGCGCTTCTAGACCGCAAATGA
>probe:Drosophila_2:1623264_at:572:333; Interrogation_Position=4719; Antisense; GCTGACTCTGCAGGCATTTCGAGTA
>probe:Drosophila_2:1623264_at:382:319; Interrogation_Position=4750; Antisense; GCCGCTGATGTATGTGTATGCCGCA
>probe:Drosophila_2:1623264_at:717:681; Interrogation_Position=4766; Antisense; TATGCCGCATCCTAGATCCATGTTA
>probe:Drosophila_2:1623264_at:284:483; Interrogation_Position=4811; Antisense; GTATAGCTACTTCTGTCCAAATCCA
>probe:Drosophila_2:1623264_at:414:629; Interrogation_Position=4832; Antisense; TCCACGCTAAGCACTTTTGTACATT
>probe:Drosophila_2:1623264_at:420:461; Interrogation_Position=4859; Antisense; GATTACGCTTTCCTTTGTTTCATTC
>probe:Drosophila_2:1623264_at:124:691; Interrogation_Position=4872; Antisense; TTTGTTTCATTCACTTGCTTGCGCT
>probe:Drosophila_2:1623264_at:373:97; Interrogation_Position=4986; Antisense; AGATCCGCAGCGCAGTTGGCATTTA

Paste this into a BLAST search page for me
GTCAAGGTGATATCGGCAGTGCTCACAGTGCTCAAATTTTCGCCGCAGCAAAAAGGAGCATCAGCGGCGATCGCTAGCATGAACTGATGGCTCTCTACGGGAGATTGGAACTGGGAGCCCTGCCCGGTGGCGCTTCTAGACCGCAAATGAGCTGACTCTGCAGGCATTTCGAGTAGCCGCTGATGTATGTGTATGCCGCATATGCCGCATCCTAGATCCATGTTAGTATAGCTACTTCTGTCCAAATCCATCCACGCTAAGCACTTTTGTACATTGATTACGCTTTCCTTTGTTTCATTCTTTGTTTCATTCACTTGCTTGCGCTAGATCCGCAGCGCAGTTGGCATTTA

Full Affymetrix probeset data:

Annotations for 1623264_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime