FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623265_at:

>probe:Drosophila_2:1623265_at:37:479; Interrogation_Position=1020; Antisense; GTTTCAGTATTATCACACGGTGCTC
>probe:Drosophila_2:1623265_at:290:339; Interrogation_Position=1076; Antisense; GCTACATTCCCACATTGAGGCAGTT
>probe:Drosophila_2:1623265_at:282:71; Interrogation_Position=1093; Antisense; AGGCAGTTCGTCCTGCAGCTCGAAA
>probe:Drosophila_2:1623265_at:539:525; Interrogation_Position=1119; Antisense; GGGCAGATTCTTTGCTGTCACAGTC
>probe:Drosophila_2:1623265_at:185:537; Interrogation_Position=1149; Antisense; GGTCTGCCAGGCCATATTGACCAAT
>probe:Drosophila_2:1623265_at:187:319; Interrogation_Position=1183; Antisense; GCCGATGCCGACTTTAATGCTTTGA
>probe:Drosophila_2:1623265_at:48:135; Interrogation_Position=1293; Antisense; ACGCTTCGATCGGAGTGGTCTACTA
>probe:Drosophila_2:1623265_at:525:655; Interrogation_Position=831; Antisense; TAATACATTGGTGCACGGTGACTAC
>probe:Drosophila_2:1623265_at:78:251; Interrogation_Position=864; Antisense; CAATGTGATGTTGCGCTACGGCGAA
>probe:Drosophila_2:1623265_at:430:75; Interrogation_Position=893; Antisense; AGGAGCCACTGGACATGACTCTCAT
>probe:Drosophila_2:1623265_at:549:647; Interrogation_Position=914; Antisense; TCATCGACTTCCAATTCTGCAGTTG
>probe:Drosophila_2:1623265_at:618:519; Interrogation_Position=952; Antisense; GTGGATCTGCACTACTTCTTCAACA
>probe:Drosophila_2:1623265_at:68:715; Interrogation_Position=967; Antisense; TTCTTCAACACTTCGGTGCAGGTCG
>probe:Drosophila_2:1623265_at:590:509; Interrogation_Position=982; Antisense; GTGCAGGTCGATATTCGCTACGAAC

Paste this into a BLAST search page for me
GTTTCAGTATTATCACACGGTGCTCGCTACATTCCCACATTGAGGCAGTTAGGCAGTTCGTCCTGCAGCTCGAAAGGGCAGATTCTTTGCTGTCACAGTCGGTCTGCCAGGCCATATTGACCAATGCCGATGCCGACTTTAATGCTTTGAACGCTTCGATCGGAGTGGTCTACTATAATACATTGGTGCACGGTGACTACCAATGTGATGTTGCGCTACGGCGAAAGGAGCCACTGGACATGACTCTCATTCATCGACTTCCAATTCTGCAGTTGGTGGATCTGCACTACTTCTTCAACATTCTTCAACACTTCGGTGCAGGTCGGTGCAGGTCGATATTCGCTACGAAC

Full Affymetrix probeset data:

Annotations for 1623265_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720