FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623267_at:

>probe:Drosophila_2:1623267_at:617:489; Interrogation_Position=8556; Antisense; GTACTTGGAGCAGATGGCCCACAAT
>probe:Drosophila_2:1623267_at:132:435; Interrogation_Position=8596; Antisense; GAGGGCAGCACGTTAGGCGTTCTTT
>probe:Drosophila_2:1623267_at:131:71; Interrogation_Position=8610; Antisense; AGGCGTTCTTTTTGAGTTCTGGGCA
>probe:Drosophila_2:1623267_at:281:619; Interrogation_Position=8647; Antisense; TGCATCTTGCAATTGGTGTCCCACG
>probe:Drosophila_2:1623267_at:249:287; Interrogation_Position=8710; Antisense; CTGGACTTTCAGACGCAGAGTGCTA
>probe:Drosophila_2:1623267_at:317:101; Interrogation_Position=8726; Antisense; AGAGTGCTAACTCCAAGCTGTCCGA
>probe:Drosophila_2:1623267_at:56:97; Interrogation_Position=8750; Antisense; AGATGGTCAATCTGCACTTCCTTAG
>probe:Drosophila_2:1623267_at:420:73; Interrogation_Position=8792; Antisense; AGGACACCAATTCCACAGTGCTGGG
>probe:Drosophila_2:1623267_at:588:525; Interrogation_Position=8814; Antisense; GGGCAAACTGCTACCCATGTGGAGC
>probe:Drosophila_2:1623267_at:589:403; Interrogation_Position=8902; Antisense; GACTATGCACCGGACTACGAGGAGC
>probe:Drosophila_2:1623267_at:500:491; Interrogation_Position=8934; Antisense; GTACAAGTCGGAGGCTCTGCTCAAA
>probe:Drosophila_2:1623267_at:6:619; Interrogation_Position=8951; Antisense; TGCTCAAATGGCTGCAGCGCTTGCA
>probe:Drosophila_2:1623267_at:379:127; Interrogation_Position=9012; Antisense; AGCCACGCAGTTCTATTCAATCTAA
>probe:Drosophila_2:1623267_at:603:729; Interrogation_Position=9081; Antisense; TTGGTAATTGTTGCCTACGCGAATA

Paste this into a BLAST search page for me
GTACTTGGAGCAGATGGCCCACAATGAGGGCAGCACGTTAGGCGTTCTTTAGGCGTTCTTTTTGAGTTCTGGGCATGCATCTTGCAATTGGTGTCCCACGCTGGACTTTCAGACGCAGAGTGCTAAGAGTGCTAACTCCAAGCTGTCCGAAGATGGTCAATCTGCACTTCCTTAGAGGACACCAATTCCACAGTGCTGGGGGGCAAACTGCTACCCATGTGGAGCGACTATGCACCGGACTACGAGGAGCGTACAAGTCGGAGGCTCTGCTCAAATGCTCAAATGGCTGCAGCGCTTGCAAGCCACGCAGTTCTATTCAATCTAATTGGTAATTGTTGCCTACGCGAATA

Full Affymetrix probeset data:

Annotations for 1623267_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720