Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623271_a_at:

>probe:Drosophila_2:1623271_a_at:176:439; Interrogation_Position=104; Antisense; GAGGAAGCACTTGCCGGCGTGCCAC
>probe:Drosophila_2:1623271_a_at:575:591; Interrogation_Position=129; Antisense; TGGTGCACATCAGTCCAGAGGGCAT
>probe:Drosophila_2:1623271_a_at:137:435; Interrogation_Position=146; Antisense; GAGGGCATCTTCAAGTATGTCATGA
>probe:Drosophila_2:1623271_a_at:339:497; Interrogation_Position=164; Antisense; GTCATGATCAATGTCTTCGATGGAG
>probe:Drosophila_2:1623271_a_at:505:97; Interrogation_Position=190; Antisense; AGATGCTTCAAAGGCGGTGATCCGC
>probe:Drosophila_2:1623271_a_at:453:19; Interrogation_Position=217; Antisense; ATTTGCGGACTGCACATGGCATGCC
>probe:Drosophila_2:1623271_a_at:557:573; Interrogation_Position=302; Antisense; GGCGGCGGTCGCATTGAACACAATC
>probe:Drosophila_2:1623271_a_at:145:617; Interrogation_Position=338; Antisense; TACTTGAAGGTCTACGGATACTCGC
>probe:Drosophila_2:1623271_a_at:123:141; Interrogation_Position=351; Antisense; ACGGATACTCGCAGGGCTTTGGAAA
>probe:Drosophila_2:1623271_a_at:87:389; Interrogation_Position=372; Antisense; GAAAAGCTGATCACGCGCAGACCAA
>probe:Drosophila_2:1623271_a_at:577:241; Interrogation_Position=414; Antisense; AATACCCGGACTACACGATCGAAAT
>probe:Drosophila_2:1623271_a_at:482:375; Interrogation_Position=473; Antisense; GAAGACTCCACATAAGCACACTGAC
>probe:Drosophila_2:1623271_a_at:689:27; Interrogation_Position=506; Antisense; ATACCATTGGCTTTGATCCTGTGTG
>probe:Drosophila_2:1623271_a_at:147:449; Interrogation_Position=520; Antisense; GATCCTGTGTGCCATGATTTTATTG

Paste this into a BLAST search page for me
GAGGAAGCACTTGCCGGCGTGCCACTGGTGCACATCAGTCCAGAGGGCATGAGGGCATCTTCAAGTATGTCATGAGTCATGATCAATGTCTTCGATGGAGAGATGCTTCAAAGGCGGTGATCCGCATTTGCGGACTGCACATGGCATGCCGGCGGCGGTCGCATTGAACACAATCTACTTGAAGGTCTACGGATACTCGCACGGATACTCGCAGGGCTTTGGAAAGAAAAGCTGATCACGCGCAGACCAAAATACCCGGACTACACGATCGAAATGAAGACTCCACATAAGCACACTGACATACCATTGGCTTTGATCCTGTGTGGATCCTGTGTGCCATGATTTTATTG

Full Affymetrix probeset data:

Annotations for 1623271_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime